ID: 923915423

View in Genome Browser
Species Human (GRCh38)
Location 1:238497736-238497758
Sequence CTTTATAAGCAGTATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923915417_923915423 30 Left 923915417 1:238497683-238497705 CCGTGAGTCAATTAAACCTGTTT No data
Right 923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG No data
923915422_923915423 -7 Left 923915422 1:238497720-238497742 CCAGTCTCGGGTATGTCTTTATA 0: 36
1: 1587
2: 9198
3: 13069
4: 11945
Right 923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG No data
923915421_923915423 -6 Left 923915421 1:238497719-238497741 CCCAGTCTCGGGTATGTCTTTAT 0: 1089
1: 6581
2: 9092
3: 10197
4: 9715
Right 923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG No data
923915418_923915423 14 Left 923915418 1:238497699-238497721 CCTGTTTTCTTTATAAATTACCC 0: 96
1: 4523
2: 10131
3: 9129
4: 5480
Right 923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923915423 Original CRISPR CTTTATAAGCAGTATGAGAA TGG Intergenic
No off target data available for this crispr