ID: 923915614

View in Genome Browser
Species Human (GRCh38)
Location 1:238500343-238500365
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923915614_923915617 17 Left 923915614 1:238500343-238500365 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 923915617 1:238500383-238500405 TTTATAAACTACACAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923915614 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr