ID: 923915617

View in Genome Browser
Species Human (GRCh38)
Location 1:238500383-238500405
Sequence TTTATAAACTACACAGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923915611_923915617 22 Left 923915611 1:238500338-238500360 CCTCCCCAGTCACGTGGAACTGT 0: 45
1: 1158
2: 6120
3: 7523
4: 6990
Right 923915617 1:238500383-238500405 TTTATAAACTACACAGTCTCAGG No data
923915614_923915617 17 Left 923915614 1:238500343-238500365 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 923915617 1:238500383-238500405 TTTATAAACTACACAGTCTCAGG No data
923915615_923915617 -5 Left 923915615 1:238500365-238500387 CCATTAAACCTCTTTTTCTTTAT 0: 1338
1: 1566
2: 1040
3: 923
4: 2126
Right 923915617 1:238500383-238500405 TTTATAAACTACACAGTCTCAGG No data
923915612_923915617 19 Left 923915612 1:238500341-238500363 CCCCAGTCACGTGGAACTGTGAG 0: 33
1: 933
2: 5305
3: 8080
4: 8275
Right 923915617 1:238500383-238500405 TTTATAAACTACACAGTCTCAGG No data
923915613_923915617 18 Left 923915613 1:238500342-238500364 CCCAGTCACGTGGAACTGTGAGT 0: 34
1: 969
2: 5547
3: 8202
4: 8230
Right 923915617 1:238500383-238500405 TTTATAAACTACACAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923915617 Original CRISPR TTTATAAACTACACAGTCTC AGG Intergenic
No off target data available for this crispr