ID: 923915660

View in Genome Browser
Species Human (GRCh38)
Location 1:238500945-238500967
Sequence CTAGTGAAGCACCCTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923915656_923915660 7 Left 923915656 1:238500915-238500937 CCTTTTAGGTTTCAGCTGCCAGC No data
Right 923915660 1:238500945-238500967 CTAGTGAAGCACCCTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923915660 Original CRISPR CTAGTGAAGCACCCTGTGCC TGG Intergenic
No off target data available for this crispr