ID: 923928105

View in Genome Browser
Species Human (GRCh38)
Location 1:238659044-238659066
Sequence ACTGACAAACACACTCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923928105_923928106 7 Left 923928105 1:238659044-238659066 CCATAAGGAGTGTGTTTGTCAGT No data
Right 923928106 1:238659074-238659096 TCTCCGTTTTACATGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923928105 Original CRISPR ACTGACAAACACACTCCTTA TGG (reversed) Intergenic
No off target data available for this crispr