ID: 923933136

View in Genome Browser
Species Human (GRCh38)
Location 1:238726510-238726532
Sequence CAGTGACACCAGAGGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923933124_923933136 18 Left 923933124 1:238726469-238726491 CCTCTAGGGTGGGGTAGGAAGCC No data
Right 923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG No data
923933128_923933136 -4 Left 923933128 1:238726491-238726513 CCAGCTCCCCACTGGGCCTCAGT No data
Right 923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG No data
923933127_923933136 -3 Left 923933127 1:238726490-238726512 CCCAGCTCCCCACTGGGCCTCAG No data
Right 923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG No data
923933129_923933136 -10 Left 923933129 1:238726497-238726519 CCCCACTGGGCCTCAGTGACACC No data
Right 923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923933136 Original CRISPR CAGTGACACCAGAGGAAGGG AGG Intergenic
No off target data available for this crispr