ID: 923934819

View in Genome Browser
Species Human (GRCh38)
Location 1:238748455-238748477
Sequence CCAGTGATGAAATGGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923934811_923934819 -10 Left 923934811 1:238748442-238748464 CCTAAATGGGACCCCAGTGATGA No data
Right 923934819 1:238748455-238748477 CCAGTGATGAAATGGGGGAATGG No data
923934810_923934819 -9 Left 923934810 1:238748441-238748463 CCCTAAATGGGACCCCAGTGATG No data
Right 923934819 1:238748455-238748477 CCAGTGATGAAATGGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923934819 Original CRISPR CCAGTGATGAAATGGGGGAA TGG Intergenic
No off target data available for this crispr