ID: 923937656

View in Genome Browser
Species Human (GRCh38)
Location 1:238781381-238781403
Sequence GTTCAGCACCATCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923937656_923937658 5 Left 923937656 1:238781381-238781403 CCTACAGCATGATGGTGCTGAAC No data
Right 923937658 1:238781409-238781431 TTCTGATTTGGCATCTCCTTTGG No data
923937656_923937659 11 Left 923937656 1:238781381-238781403 CCTACAGCATGATGGTGCTGAAC No data
Right 923937659 1:238781415-238781437 TTTGGCATCTCCTTTGGCTGAGG No data
923937656_923937657 -7 Left 923937656 1:238781381-238781403 CCTACAGCATGATGGTGCTGAAC No data
Right 923937657 1:238781397-238781419 GCTGAACAGACATTCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923937656 Original CRISPR GTTCAGCACCATCATGCTGT AGG (reversed) Intergenic
No off target data available for this crispr