ID: 923940438

View in Genome Browser
Species Human (GRCh38)
Location 1:238817367-238817389
Sequence GTTCTAATGGGCTACCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923940438_923940444 13 Left 923940438 1:238817367-238817389 CCATCTTGGTAGCCCATTAGAAC No data
Right 923940444 1:238817403-238817425 GGTTCATGGACATTGAAAAAAGG No data
923940438_923940441 -8 Left 923940438 1:238817367-238817389 CCATCTTGGTAGCCCATTAGAAC No data
Right 923940441 1:238817382-238817404 ATTAGAACCTATCAAACTTATGG No data
923940438_923940443 -1 Left 923940438 1:238817367-238817389 CCATCTTGGTAGCCCATTAGAAC No data
Right 923940443 1:238817389-238817411 CCTATCAAACTTATGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923940438 Original CRISPR GTTCTAATGGGCTACCAAGA TGG (reversed) Intergenic
No off target data available for this crispr