ID: 923940443

View in Genome Browser
Species Human (GRCh38)
Location 1:238817389-238817411
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923940438_923940443 -1 Left 923940438 1:238817367-238817389 CCATCTTGGTAGCCCATTAGAAC No data
Right 923940443 1:238817389-238817411 CCTATCAAACTTATGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr