ID: 923956306

View in Genome Browser
Species Human (GRCh38)
Location 1:239025565-239025587
Sequence GTGGTAGGCCTGGTGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923956306_923956313 5 Left 923956306 1:239025565-239025587 CCATCCATCACCAGGCCTACCAC No data
Right 923956313 1:239025593-239025615 TTTGCGTGACTCAGATATGGAGG No data
923956306_923956312 2 Left 923956306 1:239025565-239025587 CCATCCATCACCAGGCCTACCAC No data
Right 923956312 1:239025590-239025612 ATATTTGCGTGACTCAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923956306 Original CRISPR GTGGTAGGCCTGGTGATGGA TGG (reversed) Intergenic
No off target data available for this crispr