ID: 923956849

View in Genome Browser
Species Human (GRCh38)
Location 1:239031954-239031976
Sequence TATTATCACTTTAATGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923956849_923956856 22 Left 923956849 1:239031954-239031976 CCTTGTACATTAAAGTGATAATA No data
Right 923956856 1:239031999-239032021 GCCTGTAATCCCAGCATTTTGGG 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
923956849_923956853 -6 Left 923956849 1:239031954-239031976 CCTTGTACATTAAAGTGATAATA No data
Right 923956853 1:239031971-239031993 ATAATATGGGCCATGCATGGTGG No data
923956849_923956858 25 Left 923956849 1:239031954-239031976 CCTTGTACATTAAAGTGATAATA No data
Right 923956858 1:239032002-239032024 TGTAATCCCAGCATTTTGGGAGG 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
923956849_923956855 21 Left 923956849 1:239031954-239031976 CCTTGTACATTAAAGTGATAATA No data
Right 923956855 1:239031998-239032020 TGCCTGTAATCCCAGCATTTTGG 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654
923956849_923956852 -9 Left 923956849 1:239031954-239031976 CCTTGTACATTAAAGTGATAATA No data
Right 923956852 1:239031968-239031990 GTGATAATATGGGCCATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923956849 Original CRISPR TATTATCACTTTAATGTACA AGG (reversed) Intergenic
No off target data available for this crispr