ID: 923959363

View in Genome Browser
Species Human (GRCh38)
Location 1:239059277-239059299
Sequence ACAATCCCTAGAGGCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923959363_923959371 27 Left 923959363 1:239059277-239059299 CCCTGGCTGCCTCTAGGGATTGT No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959363_923959370 16 Left 923959363 1:239059277-239059299 CCCTGGCTGCCTCTAGGGATTGT No data
Right 923959370 1:239059316-239059338 CTACAAAACTTCTTCCTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923959363 Original CRISPR ACAATCCCTAGAGGCAGCCA GGG (reversed) Intergenic
No off target data available for this crispr