ID: 923959366

View in Genome Browser
Species Human (GRCh38)
Location 1:239059302-239059324
Sequence GTTTTGTAGTGGTGAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923959366_923959375 23 Left 923959366 1:239059302-239059324 CCTCCCATTCACCACTACAAAAC No data
Right 923959375 1:239059348-239059370 GGCCAAGCCACGCTGGACTCAGG No data
923959366_923959371 2 Left 923959366 1:239059302-239059324 CCTCCCATTCACCACTACAAAAC No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959366_923959376 24 Left 923959366 1:239059302-239059324 CCTCCCATTCACCACTACAAAAC No data
Right 923959376 1:239059349-239059371 GCCAAGCCACGCTGGACTCAGGG No data
923959366_923959370 -9 Left 923959366 1:239059302-239059324 CCTCCCATTCACCACTACAAAAC No data
Right 923959370 1:239059316-239059338 CTACAAAACTTCTTCCTCGAAGG No data
923959366_923959373 16 Left 923959366 1:239059302-239059324 CCTCCCATTCACCACTACAAAAC No data
Right 923959373 1:239059341-239059363 TCCAGCAGGCCAAGCCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923959366 Original CRISPR GTTTTGTAGTGGTGAATGGG AGG (reversed) Intergenic
No off target data available for this crispr