ID: 923959367

View in Genome Browser
Species Human (GRCh38)
Location 1:239059305-239059327
Sequence GAAGTTTTGTAGTGGTGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923959367_923959371 -1 Left 923959367 1:239059305-239059327 CCCATTCACCACTACAAAACTTC No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959367_923959376 21 Left 923959367 1:239059305-239059327 CCCATTCACCACTACAAAACTTC No data
Right 923959376 1:239059349-239059371 GCCAAGCCACGCTGGACTCAGGG No data
923959367_923959375 20 Left 923959367 1:239059305-239059327 CCCATTCACCACTACAAAACTTC No data
Right 923959375 1:239059348-239059370 GGCCAAGCCACGCTGGACTCAGG No data
923959367_923959373 13 Left 923959367 1:239059305-239059327 CCCATTCACCACTACAAAACTTC No data
Right 923959373 1:239059341-239059363 TCCAGCAGGCCAAGCCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923959367 Original CRISPR GAAGTTTTGTAGTGGTGAAT GGG (reversed) Intergenic
No off target data available for this crispr