ID: 923959368

View in Genome Browser
Species Human (GRCh38)
Location 1:239059306-239059328
Sequence AGAAGTTTTGTAGTGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923959368_923959376 20 Left 923959368 1:239059306-239059328 CCATTCACCACTACAAAACTTCT No data
Right 923959376 1:239059349-239059371 GCCAAGCCACGCTGGACTCAGGG No data
923959368_923959371 -2 Left 923959368 1:239059306-239059328 CCATTCACCACTACAAAACTTCT No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959368_923959375 19 Left 923959368 1:239059306-239059328 CCATTCACCACTACAAAACTTCT No data
Right 923959375 1:239059348-239059370 GGCCAAGCCACGCTGGACTCAGG No data
923959368_923959373 12 Left 923959368 1:239059306-239059328 CCATTCACCACTACAAAACTTCT No data
Right 923959373 1:239059341-239059363 TCCAGCAGGCCAAGCCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923959368 Original CRISPR AGAAGTTTTGTAGTGGTGAA TGG (reversed) Intergenic