ID: 923959370

View in Genome Browser
Species Human (GRCh38)
Location 1:239059316-239059338
Sequence CTACAAAACTTCTTCCTCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923959366_923959370 -9 Left 923959366 1:239059302-239059324 CCTCCCATTCACCACTACAAAAC No data
Right 923959370 1:239059316-239059338 CTACAAAACTTCTTCCTCGAAGG No data
923959365_923959370 7 Left 923959365 1:239059286-239059308 CCTCTAGGGATTGTCTCCTCCCA No data
Right 923959370 1:239059316-239059338 CTACAAAACTTCTTCCTCGAAGG No data
923959363_923959370 16 Left 923959363 1:239059277-239059299 CCCTGGCTGCCTCTAGGGATTGT No data
Right 923959370 1:239059316-239059338 CTACAAAACTTCTTCCTCGAAGG No data
923959364_923959370 15 Left 923959364 1:239059278-239059300 CCTGGCTGCCTCTAGGGATTGTC No data
Right 923959370 1:239059316-239059338 CTACAAAACTTCTTCCTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923959370 Original CRISPR CTACAAAACTTCTTCCTCGA AGG Intergenic
No off target data available for this crispr