ID: 923959371

View in Genome Browser
Species Human (GRCh38)
Location 1:239059327-239059349
Sequence CTTCCTCGAAGGTGTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923959363_923959371 27 Left 923959363 1:239059277-239059299 CCCTGGCTGCCTCTAGGGATTGT No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959367_923959371 -1 Left 923959367 1:239059305-239059327 CCCATTCACCACTACAAAACTTC No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959364_923959371 26 Left 923959364 1:239059278-239059300 CCTGGCTGCCTCTAGGGATTGTC No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959369_923959371 -9 Left 923959369 1:239059313-239059335 CCACTACAAAACTTCTTCCTCGA No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959368_923959371 -2 Left 923959368 1:239059306-239059328 CCATTCACCACTACAAAACTTCT No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959365_923959371 18 Left 923959365 1:239059286-239059308 CCTCTAGGGATTGTCTCCTCCCA No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data
923959366_923959371 2 Left 923959366 1:239059302-239059324 CCTCCCATTCACCACTACAAAAC No data
Right 923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923959371 Original CRISPR CTTCCTCGAAGGTGTCCAGC AGG Intergenic
No off target data available for this crispr