ID: 923959376

View in Genome Browser
Species Human (GRCh38)
Location 1:239059349-239059371
Sequence GCCAAGCCACGCTGGACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923959368_923959376 20 Left 923959368 1:239059306-239059328 CCATTCACCACTACAAAACTTCT No data
Right 923959376 1:239059349-239059371 GCCAAGCCACGCTGGACTCAGGG No data
923959367_923959376 21 Left 923959367 1:239059305-239059327 CCCATTCACCACTACAAAACTTC No data
Right 923959376 1:239059349-239059371 GCCAAGCCACGCTGGACTCAGGG No data
923959369_923959376 13 Left 923959369 1:239059313-239059335 CCACTACAAAACTTCTTCCTCGA No data
Right 923959376 1:239059349-239059371 GCCAAGCCACGCTGGACTCAGGG No data
923959372_923959376 -4 Left 923959372 1:239059330-239059352 CCTCGAAGGTGTCCAGCAGGCCA No data
Right 923959376 1:239059349-239059371 GCCAAGCCACGCTGGACTCAGGG No data
923959366_923959376 24 Left 923959366 1:239059302-239059324 CCTCCCATTCACCACTACAAAAC No data
Right 923959376 1:239059349-239059371 GCCAAGCCACGCTGGACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923959376 Original CRISPR GCCAAGCCACGCTGGACTCA GGG Intergenic
No off target data available for this crispr