ID: 923959379

View in Genome Browser
Species Human (GRCh38)
Location 1:239059361-239059383
Sequence TGGACTCAGGGATCTCCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923959374_923959379 -4 Left 923959374 1:239059342-239059364 CCAGCAGGCCAAGCCACGCTGGA No data
Right 923959379 1:239059361-239059383 TGGACTCAGGGATCTCCCCACGG No data
923959369_923959379 25 Left 923959369 1:239059313-239059335 CCACTACAAAACTTCTTCCTCGA No data
Right 923959379 1:239059361-239059383 TGGACTCAGGGATCTCCCCACGG No data
923959372_923959379 8 Left 923959372 1:239059330-239059352 CCTCGAAGGTGTCCAGCAGGCCA No data
Right 923959379 1:239059361-239059383 TGGACTCAGGGATCTCCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923959379 Original CRISPR TGGACTCAGGGATCTCCCCA CGG Intergenic
No off target data available for this crispr