ID: 923959653

View in Genome Browser
Species Human (GRCh38)
Location 1:239063303-239063325
Sequence TTATGGATAAGTAGTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923959647_923959653 2 Left 923959647 1:239063278-239063300 CCAAATGTTTGAAGCAGCCTCTG No data
Right 923959653 1:239063303-239063325 TTATGGATAAGTAGTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923959653 Original CRISPR TTATGGATAAGTAGTTCTCT GGG Intergenic
No off target data available for this crispr