ID: 923964297

View in Genome Browser
Species Human (GRCh38)
Location 1:239119536-239119558
Sequence TACCCAAGGTTGGTAGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923964292_923964297 1 Left 923964292 1:239119512-239119534 CCTCTAGCCCGTACAGTGGAGAA No data
Right 923964297 1:239119536-239119558 TACCCAAGGTTGGTAGAGAGTGG No data
923964294_923964297 -7 Left 923964294 1:239119520-239119542 CCGTACAGTGGAGAAATACCCAA No data
Right 923964297 1:239119536-239119558 TACCCAAGGTTGGTAGAGAGTGG No data
923964293_923964297 -6 Left 923964293 1:239119519-239119541 CCCGTACAGTGGAGAAATACCCA No data
Right 923964297 1:239119536-239119558 TACCCAAGGTTGGTAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923964297 Original CRISPR TACCCAAGGTTGGTAGAGAG TGG Intergenic
No off target data available for this crispr