ID: 923965923

View in Genome Browser
Species Human (GRCh38)
Location 1:239139018-239139040
Sequence CAAGCACAGGATGTTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923965917_923965923 3 Left 923965917 1:239138992-239139014 CCTGTAGAGGACAATATTCTGCT No data
Right 923965923 1:239139018-239139040 CAAGCACAGGATGTTGTGGTGGG No data
923965916_923965923 10 Left 923965916 1:239138985-239139007 CCGGACTCCTGTAGAGGACAATA No data
Right 923965923 1:239139018-239139040 CAAGCACAGGATGTTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923965923 Original CRISPR CAAGCACAGGATGTTGTGGT GGG Intergenic
No off target data available for this crispr