ID: 923966387

View in Genome Browser
Species Human (GRCh38)
Location 1:239144655-239144677
Sequence AAACTTGAACTGTTACTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923966386_923966387 6 Left 923966386 1:239144626-239144648 CCTTTAAATTCATTATTTTAAAT No data
Right 923966387 1:239144655-239144677 AAACTTGAACTGTTACTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923966387 Original CRISPR AAACTTGAACTGTTACTAAA AGG Intergenic
No off target data available for this crispr