ID: 923966761

View in Genome Browser
Species Human (GRCh38)
Location 1:239150114-239150136
Sequence CCTTATCTGCAAAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923966761_923966764 -8 Left 923966761 1:239150114-239150136 CCATCCACTTTTTGCAGATAAGG No data
Right 923966764 1:239150129-239150151 AGATAAGGAAAAAGAAACACAGG No data
923966761_923966765 24 Left 923966761 1:239150114-239150136 CCATCCACTTTTTGCAGATAAGG No data
Right 923966765 1:239150161-239150183 TTGAGCCTCGCTGTAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923966761 Original CRISPR CCTTATCTGCAAAAAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr