ID: 923967270

View in Genome Browser
Species Human (GRCh38)
Location 1:239155890-239155912
Sequence GCACTCTCTCCTGGCAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923967270_923967273 3 Left 923967270 1:239155890-239155912 CCCTGACTGCCAGGAGAGAGTGC No data
Right 923967273 1:239155916-239155938 AGACACCAGTTGCAAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923967270 Original CRISPR GCACTCTCTCCTGGCAGTCA GGG (reversed) Intergenic