ID: 923967273

View in Genome Browser
Species Human (GRCh38)
Location 1:239155916-239155938
Sequence AGACACCAGTTGCAAGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923967272_923967273 -6 Left 923967272 1:239155899-239155921 CCAGGAGAGAGTGCTTCAGACAC No data
Right 923967273 1:239155916-239155938 AGACACCAGTTGCAAGTCTCAGG No data
923967270_923967273 3 Left 923967270 1:239155890-239155912 CCCTGACTGCCAGGAGAGAGTGC No data
Right 923967273 1:239155916-239155938 AGACACCAGTTGCAAGTCTCAGG No data
923967269_923967273 11 Left 923967269 1:239155882-239155904 CCATTCTACCCTGACTGCCAGGA No data
Right 923967273 1:239155916-239155938 AGACACCAGTTGCAAGTCTCAGG No data
923967266_923967273 15 Left 923967266 1:239155878-239155900 CCTCCCATTCTACCCTGACTGCC No data
Right 923967273 1:239155916-239155938 AGACACCAGTTGCAAGTCTCAGG No data
923967265_923967273 27 Left 923967265 1:239155866-239155888 CCAGCTGGGTGTCCTCCCATTCT No data
Right 923967273 1:239155916-239155938 AGACACCAGTTGCAAGTCTCAGG No data
923967267_923967273 12 Left 923967267 1:239155881-239155903 CCCATTCTACCCTGACTGCCAGG No data
Right 923967273 1:239155916-239155938 AGACACCAGTTGCAAGTCTCAGG No data
923967271_923967273 2 Left 923967271 1:239155891-239155913 CCTGACTGCCAGGAGAGAGTGCT No data
Right 923967273 1:239155916-239155938 AGACACCAGTTGCAAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923967273 Original CRISPR AGACACCAGTTGCAAGTCTC AGG Intergenic