ID: 923967992

View in Genome Browser
Species Human (GRCh38)
Location 1:239165052-239165074
Sequence CAGTATAAGTAGGTGAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923967992_923967995 3 Left 923967992 1:239165052-239165074 CCTCTATTCACCTACTTATACTG No data
Right 923967995 1:239165078-239165100 AAAATATTGATCTCTTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923967992 Original CRISPR CAGTATAAGTAGGTGAATAG AGG (reversed) Intergenic
No off target data available for this crispr