ID: 923969619

View in Genome Browser
Species Human (GRCh38)
Location 1:239185289-239185311
Sequence TCATCTTTTTATAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923969615_923969619 22 Left 923969615 1:239185244-239185266 CCCTTTTTGGGAGAAAGAAAGGT No data
Right 923969619 1:239185289-239185311 TCATCTTTTTATAAGGTGGATGG No data
923969616_923969619 21 Left 923969616 1:239185245-239185267 CCTTTTTGGGAGAAAGAAAGGTG No data
Right 923969619 1:239185289-239185311 TCATCTTTTTATAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923969619 Original CRISPR TCATCTTTTTATAAGGTGGA TGG Intergenic
No off target data available for this crispr