ID: 923972949

View in Genome Browser
Species Human (GRCh38)
Location 1:239226237-239226259
Sequence GCAATGGTGTTAGATGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923972947_923972949 -3 Left 923972947 1:239226217-239226239 CCTTGTGGTGGTATATGCAAGCA No data
Right 923972949 1:239226237-239226259 GCAATGGTGTTAGATGTGCTAGG No data
923972943_923972949 18 Left 923972943 1:239226196-239226218 CCTCGCATGACTGTCCTTGTGCC No data
Right 923972949 1:239226237-239226259 GCAATGGTGTTAGATGTGCTAGG No data
923972946_923972949 4 Left 923972946 1:239226210-239226232 CCTTGTGCCTTGTGGTGGTATAT No data
Right 923972949 1:239226237-239226259 GCAATGGTGTTAGATGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923972949 Original CRISPR GCAATGGTGTTAGATGTGCT AGG Intergenic
No off target data available for this crispr