ID: 923974052

View in Genome Browser
Species Human (GRCh38)
Location 1:239239846-239239868
Sequence GACACACATGGTATCCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923974052_923974058 25 Left 923974052 1:239239846-239239868 CCAGACTGGATACCATGTGTGTC No data
Right 923974058 1:239239894-239239916 ATGTGTTTCTTCTTCCCTACAGG No data
923974052_923974059 29 Left 923974052 1:239239846-239239868 CCAGACTGGATACCATGTGTGTC No data
Right 923974059 1:239239898-239239920 GTTTCTTCTTCCCTACAGGATGG No data
923974052_923974055 -2 Left 923974052 1:239239846-239239868 CCAGACTGGATACCATGTGTGTC No data
Right 923974055 1:239239867-239239889 TCTTATAAAGGAGCCAAAAATGG No data
923974052_923974060 30 Left 923974052 1:239239846-239239868 CCAGACTGGATACCATGTGTGTC No data
Right 923974060 1:239239899-239239921 TTTCTTCTTCCCTACAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923974052 Original CRISPR GACACACATGGTATCCAGTC TGG (reversed) Intergenic
No off target data available for this crispr