ID: 923982742

View in Genome Browser
Species Human (GRCh38)
Location 1:239343662-239343684
Sequence TGGGACTCTTTTGGAACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923982737_923982742 22 Left 923982737 1:239343617-239343639 CCACATCATTATTTCTAAATTAA No data
Right 923982742 1:239343662-239343684 TGGGACTCTTTTGGAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923982742 Original CRISPR TGGGACTCTTTTGGAACAAA TGG Intergenic
No off target data available for this crispr