ID: 923982766

View in Genome Browser
Species Human (GRCh38)
Location 1:239343984-239344006
Sequence CTCTAAATGCAGTTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923982758_923982766 27 Left 923982758 1:239343934-239343956 CCAAAGAAACGTGTAAAGGAAGA No data
Right 923982766 1:239343984-239344006 CTCTAAATGCAGTTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923982766 Original CRISPR CTCTAAATGCAGTTGGGGCT GGG Intergenic
No off target data available for this crispr