ID: 923994330

View in Genome Browser
Species Human (GRCh38)
Location 1:239475566-239475588
Sequence TGGGATCTTAGAATAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 979
Summary {0: 1, 1: 8, 2: 44, 3: 226, 4: 700}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923994325_923994330 19 Left 923994325 1:239475524-239475546 CCTAGGGATATATGACAAGTAAA 0: 1
1: 0
2: 2
3: 37
4: 343
Right 923994330 1:239475566-239475588 TGGGATCTTAGAATAGAAAAAGG 0: 1
1: 8
2: 44
3: 226
4: 700
923994324_923994330 28 Left 923994324 1:239475515-239475537 CCAAGAGGACCTAGGGATATATG 0: 1
1: 0
2: 1
3: 9
4: 108
Right 923994330 1:239475566-239475588 TGGGATCTTAGAATAGAAAAAGG 0: 1
1: 8
2: 44
3: 226
4: 700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923994330 Original CRISPR TGGGATCTTAGAATAGAAAA AGG Intronic
900851751 1:5149009-5149031 TGGGATCCTAGAGTTGAAAAAGG + Intergenic
901095258 1:6673714-6673736 TTGGATCCTGGAACAGAAAAAGG - Intronic
902421048 1:16280390-16280412 TGGGATCTTAGAACAGAAAAAGG + Intronic
902975926 1:20088408-20088430 TGGGATCCTGGGACAGAAAAAGG + Intronic
903302282 1:22387850-22387872 AGGGAACTTAGAAAAGAGAAAGG + Intergenic
903828205 1:26159908-26159930 TGAGGTCTTAGGATAAAAAAGGG + Intronic
904474121 1:30753699-30753721 TGCAATCTTGGAACAGAAAAAGG + Intronic
905219733 1:36436757-36436779 TGGGATTTCAGAACAGAAATAGG - Intronic
905256042 1:36685453-36685475 TTGGATCCTGGAACAGAAAAAGG - Intergenic
906536465 1:46553532-46553554 TGTGATCTTGGAACTGAAAAAGG - Intergenic
906918496 1:50037738-50037760 TGAGATCTTGGAAAAGAAAAAGG - Intergenic
907014189 1:50995283-50995305 TGGGATTATGGAACAGAAAAAGG + Intergenic
908005343 1:59722017-59722039 AGGGATGCTAGAATAGAAAAGGG - Intronic
908716427 1:67075164-67075186 TTGGATCCTGGAACAGAAAAAGG + Intergenic
908793982 1:67813044-67813066 TGGGATGTTACAACAGAAAGGGG - Intronic
909196013 1:72624410-72624432 TGGGATTTTAGAAAATATAAAGG + Intergenic
909517116 1:76523457-76523479 TGTGATCTTGCATTAGAAAAGGG + Intronic
909798418 1:79774090-79774112 TGGGATTCTGGAACAGAAAAAGG - Intergenic
910683399 1:89890797-89890819 TTGGATCCTGGACTAGAAAAAGG - Intronic
910846635 1:91610645-91610667 TGGGGTCTTGGAATAGGAAAAGG + Intergenic
911177909 1:94835352-94835374 TTAGATCCTGGAATAGAAAAAGG + Intronic
911586540 1:99697631-99697653 TGGGATTTTGGAACAGAAAAAGG - Intergenic
912340883 1:108913876-108913898 TGAGATCTTAAAATAGAAAGGGG + Intronic
913379708 1:118196111-118196133 TGGGCTCCTGGAACAGAAAAAGG - Intergenic
914390823 1:147221217-147221239 TGGGATCCTGGAACAGCAAAAGG + Intronic
914872978 1:151490826-151490848 TGGGATCCTGGAATAGAAAAAGG - Intergenic
914892468 1:151638643-151638665 TGGGATATTAGTATAGAGGAAGG + Intronic
915632897 1:157165639-157165661 CGGGATCCTAGAACAGAAACAGG + Intergenic
915836275 1:159178410-159178432 TGGGTTATCAGAATAGATAATGG + Intronic
917732934 1:177894251-177894273 TTGGATCTTGGAAGAGTAAACGG + Intergenic
918436870 1:184523548-184523570 TGGGATCCTAGAACAGAAAAAGG + Intronic
918941191 1:191000396-191000418 TGGCATCCTGGAACAGAAAAGGG + Intergenic
919268021 1:195298485-195298507 TGGTATATTGGAGTAGAAAATGG - Intergenic
920402470 1:205684883-205684905 TTGGATCTTGGAACAGAAAAGGG + Intergenic
920681532 1:208076755-208076777 TTGGATCCTAGACCAGAAAAAGG + Intronic
921408900 1:214813474-214813496 TAGAATCTTGGAACAGAAAAAGG - Intergenic
921752093 1:218807405-218807427 TGGGCTATAAGAATTGAAAAGGG + Intergenic
921835403 1:219772892-219772914 TAGGCTCTGAGAATAGAATAAGG + Intronic
921895336 1:220394124-220394146 TGGGGTCCTGAAATAGAAAAAGG + Intergenic
921984247 1:221293225-221293247 AGGCAACTTAGAAGAGAAAAAGG - Intergenic
922464303 1:225836200-225836222 TGGGATCCTGGAACAGAAAATGG + Intronic
922933186 1:229405892-229405914 TGGGATCCTGGAAGAGAAAGAGG + Intergenic
923061883 1:230483268-230483290 TAGGATCTTGGAAGAGAAAAAGG + Intergenic
923094796 1:230766613-230766635 TGGGATTCTGGAACAGAAAAAGG + Intronic
923439450 1:234002317-234002339 TGGGATCCTACAACAGAAAAAGG - Intronic
923775575 1:236975327-236975349 TGGGATATTGAAACAGAAAAAGG + Intergenic
923994330 1:239475566-239475588 TGGGATCTTAGAATAGAAAAAGG + Intronic
924185692 1:241487224-241487246 TGGGATCTTGCAACAGAGAAAGG + Intergenic
924288399 1:242511756-242511778 TGAGATCCTGGAACAGAAAAGGG + Intronic
924734159 1:246739499-246739521 TGGGATCCTGGAGCAGAAAAAGG + Intronic
1063062462 10:2570694-2570716 TGGGAACTTACTAAAGAAAATGG - Intergenic
1063301776 10:4855346-4855368 GAGTATCTTAGAATAGAATATGG + Intergenic
1063563902 10:7155141-7155163 TGGGCAATTAGAATAGAATAGGG + Intergenic
1065144197 10:22751437-22751459 TAGGATTCTAGAATAGAAATGGG - Intergenic
1065508484 10:26454138-26454160 TGGGATCTAAAAATAGAAACAGG + Intronic
1065626031 10:27629487-27629509 TTGGATTTTTGAATAGTAAATGG - Intergenic
1065793609 10:29284658-29284680 TTGGATCCTGGGATAGAAAAAGG - Intergenic
1065939059 10:30547382-30547404 TGGGATACCAGAACAGAAAAAGG - Intergenic
1065949069 10:30635107-30635129 TTGGATCCTGGGATAGAAAAAGG + Intergenic
1066080360 10:31925546-31925568 TGGGACCCTGGAACAGAAAAAGG - Intronic
1066090224 10:32011298-32011320 TGGCATCTTAGGAGGGAAAAAGG - Exonic
1066325170 10:34351939-34351961 AGGTATATTAGAATAGGAAAGGG - Intronic
1066452295 10:35541760-35541782 TGGGATCCTAAAGAAGAAAAGGG - Intronic
1066452304 10:35541824-35541846 TGGGATCCTAAAGAAGAAAAGGG - Intronic
1066452313 10:35541888-35541910 TGGGATCCTAAAGAAGAAAAGGG - Intronic
1066452334 10:35542016-35542038 TGGGATCCTAAAGAAGAAAAGGG - Intronic
1066452344 10:35542080-35542102 TGGGATCCTAAAGAAGAAAAGGG - Intronic
1067148816 10:43712849-43712871 TGGGATCCTGGAAGAGAAACAGG - Intergenic
1067395171 10:45909157-45909179 TAGGATCCTGGAACAGAAAAAGG + Intergenic
1067411436 10:46068344-46068366 TGGGACTTTGGAATAGAAAGGGG - Intergenic
1067531085 10:47074050-47074072 TGGGAACTTGGAACAGAAAAGGG - Intergenic
1067863490 10:49878289-49878311 TAGGATCCTGGAACAGAAAAAGG + Intronic
1067930036 10:50551461-50551483 TGGGATCATGGAAGAGAAAAGGG + Intronic
1068497489 10:57803463-57803485 TGGCATATTTGAATAGCAAAGGG + Intergenic
1068663858 10:59651719-59651741 TGGGATATGGGAATGGAAAAGGG - Exonic
1068853478 10:61771583-61771605 TGGGATTCTGGAACAGAAAAGGG + Intergenic
1068975153 10:63001294-63001316 TTGAATCTTGGAACAGAAAAAGG + Intergenic
1069027937 10:63564011-63564033 TGCTATCCTAGAATAGAGAAAGG + Intronic
1069199488 10:65594860-65594882 TGGGATCTTAGAACAGAAAACGG + Intergenic
1069379971 10:67833128-67833150 TTGGATCCTAGAACAGAAAAAGG + Intronic
1069429582 10:68322292-68322314 TGGGATCCTGGAACAGAAAAAGG + Intronic
1069803864 10:71104905-71104927 TGGGATCCTGGAACAGAAAAAGG + Intergenic
1069852659 10:71420173-71420195 TGGTATTTTAGAAAAGAGAAAGG - Intronic
1070287035 10:75091591-75091613 TTGGATCCTGGAACAGAAAAAGG - Intergenic
1070431193 10:76340167-76340189 TGGCATATTAAAAAAGAAAATGG + Intronic
1070609769 10:77925711-77925733 TGGGCTCTGAGCAGAGAAAAAGG + Intronic
1070984948 10:80680742-80680764 TGGGATCCTGGAACAGAAAAGGG - Intergenic
1071930824 10:90467653-90467675 TGGGATCCTGGAATAGGAAGGGG - Intergenic
1071995908 10:91149095-91149117 TTGGATTTTGGAATAGAAAAGGG + Intergenic
1072229335 10:93400532-93400554 TAGGATCTTAAAAGAGGAAAAGG + Intronic
1072315715 10:94201017-94201039 TGGGATCCTGGAACAGAAAAAGG + Intronic
1072328805 10:94325231-94325253 TGGGACCTTAAAACAGGAAAAGG + Intronic
1072749414 10:97966637-97966659 TGGGATCCTGGAACAGAAAAGGG - Intronic
1072992084 10:100206116-100206138 TGAGATCTTAGAACAGAAAAAGG + Intronic
1073109163 10:101050538-101050560 TGGGACGTGAGAAGAGAAAAGGG - Intergenic
1073272908 10:102281807-102281829 TGGAATCCTTGAACAGAAAAAGG - Intronic
1073286641 10:102393857-102393879 TGGAATATTAGAACTGAAAAAGG - Intergenic
1073847847 10:107579458-107579480 TTGAATTTTAGAATAGAAAAAGG - Intergenic
1073934258 10:108611891-108611913 TGGGATTCTGGAAGAGAAAAAGG + Intergenic
1074047933 10:109856031-109856053 TGGGATTCTGGAAGAGAAAAAGG + Intergenic
1074133366 10:110604911-110604933 TGGGATCCTAGAAAAGAAAAAGG - Intergenic
1074173766 10:110975130-110975152 TGGGATTCTAGAACAGAAAATGG - Intronic
1074198763 10:111212692-111212714 TTGGATCTTAGAATAGAGAAAGG - Intergenic
1074334346 10:112554332-112554354 TGGAATCCTGGAACAGAAAAAGG + Intronic
1074367990 10:112875468-112875490 TGGGCTCTTGGAATGGAAGAAGG - Intergenic
1074788524 10:116863546-116863568 TTGGATCCTAGAACAGAAAAAGG - Intronic
1074879028 10:117637581-117637603 CTGGATCTTGGAACAGAAAAAGG - Intergenic
1074948977 10:118309808-118309830 ATGGTTCTTAGAAGAGAAAATGG - Exonic
1075398792 10:122146799-122146821 TGGGATCCTGGAACAGAAAAAGG - Intronic
1075542199 10:123324320-123324342 TGGGATCCTACAACAGAAAAAGG + Intergenic
1075952373 10:126492056-126492078 TCGGATCCTGGAACAGAAAAAGG + Intronic
1076099110 10:127759750-127759772 TGGGATCCTGGAACTGAAAAAGG - Intergenic
1076244398 10:128934741-128934763 TGGGATCTCAAAACAGAAAATGG - Intergenic
1076281042 10:129246218-129246240 TGGCATTTTAGCATAAAAAATGG - Intergenic
1076498624 10:130916595-130916617 TGGCATCTTCGTACAGAAAAAGG - Intergenic
1077355165 11:2113054-2113076 TGGGATCCTGGAACAGAAAGAGG + Intergenic
1077452523 11:2657676-2657698 TGGGATCTTGGAACAGAAAAAGG - Intronic
1077758083 11:5057879-5057901 TGGGATGCTGGATTAGAAAAAGG - Intergenic
1078027353 11:7709705-7709727 TTGAGTCTTAGAATAGAAATGGG + Intergenic
1078158593 11:8819819-8819841 TTTGATCCTGGAATAGAAAAAGG + Intronic
1078767733 11:14315519-14315541 TGGGATCCTGGATCAGAAAAAGG + Intronic
1079210877 11:18459719-18459741 TGGGATCATGGAACAGAAAAAGG - Intronic
1079590160 11:22173823-22173845 TGGGATCTTAGAACAGAAATAGG + Intergenic
1079593616 11:22213263-22213285 TGAGATATTGGAATAGGAAAAGG - Intronic
1079600218 11:22302728-22302750 CTGGATCTTAGACTTGAAAAAGG + Intergenic
1080158266 11:29139126-29139148 TGAGATCTTGGGACAGAAAAAGG - Intergenic
1080322905 11:31035327-31035349 TTGGATCCTGGAAAAGAAAAAGG - Intronic
1081508610 11:43744633-43744655 TGGGATCCTAGATCAGAAAAAGG + Intronic
1081799119 11:45845634-45845656 TGGGAATTTAGAGGAGAAAAAGG + Intergenic
1081836248 11:46157522-46157544 AGGGATCTTGGAACAGAAAAAGG - Intergenic
1081864010 11:46349823-46349845 TGGGATCCTGGTATAGAGAAAGG - Intronic
1082218641 11:49605111-49605133 TGTGATCTCAGATAAGAAAAAGG + Intergenic
1083088836 11:60179007-60179029 ATGGATCTTGGAACAGAAAAAGG + Intronic
1083105811 11:60357371-60357393 TGGGATCCTGGAACAGAAAAAGG + Intronic
1083162930 11:60866886-60866908 TGGGATCGTGGAACAGAAAAAGG - Intergenic
1083407095 11:62465069-62465091 TGGGATCTAGGAAAAGGAAAAGG - Intronic
1084289717 11:68154161-68154183 TGGGTTCCCAGTATAGAAAAAGG - Intergenic
1085015561 11:73171786-73171808 TTGGATCTTGGAACAGAAAGAGG + Intergenic
1085094401 11:73747628-73747650 TGACATCTTGGAACAGAAAAAGG - Intronic
1085564159 11:77498083-77498105 TGGAAACGTAGAACAGAAAAAGG + Intergenic
1085646870 11:78229739-78229761 TTGGATCCTAGAGTGGAAAAGGG - Intronic
1085862760 11:80253937-80253959 TGAAATTTTAGAACAGAAAAAGG + Intergenic
1086000282 11:81975237-81975259 TGGGATCCTAACACAGAAAAAGG + Intergenic
1086128332 11:83373359-83373381 TGGGATCTTGGAATAGAAACAGG - Intergenic
1086856136 11:91868239-91868261 TGCGATCTCAGTTTAGAAAAGGG - Intergenic
1087795096 11:102448050-102448072 TAGGTTCTAAGAATACAAAATGG - Intronic
1087833820 11:102849384-102849406 AGGGGAATTAGAATAGAAAAGGG + Intergenic
1088731203 11:112684593-112684615 TGGTATCTTTGATTAGCAAAAGG + Intergenic
1088753997 11:112870493-112870515 TGGGATCCTGAAACAGAAAAAGG - Intergenic
1088802536 11:113319375-113319397 TGGGATCCTGGAATAGGAAAAGG + Intronic
1088970068 11:114766124-114766146 TGGAATATTAGAAATGAAAATGG - Intergenic
1088972681 11:114787470-114787492 TTGGATCTTAGAATTGTAAGAGG - Intergenic
1089358072 11:117868587-117868609 TGGGATCCTAGAACAGAAAAAGG + Intronic
1091235822 11:134021431-134021453 TGGGATTCCAGAATAGCAAACGG - Intergenic
1091891432 12:4057958-4057980 TTGGATCCTGGAACAGAAAAGGG - Intergenic
1091892824 12:4074206-4074228 TGGGATCCTCAAACAGAAAAAGG - Intergenic
1092204793 12:6608112-6608134 TGGGATGTCAGTATAGAAAGTGG - Intergenic
1092302902 12:7269401-7269423 TGGGATCCCAGAACAGAAAAAGG - Intergenic
1092688656 12:11081444-11081466 TAGTATGTTAGAAAAGAAAATGG + Intronic
1092781065 12:11987989-11988011 TGGGATCCTGAAATAGTAAAAGG - Intergenic
1093152494 12:15639347-15639369 TAGGAACTAAGAAAAGAAAAAGG + Intronic
1093346455 12:18041778-18041800 GGGGATCTAAGTATATAAAAAGG + Intergenic
1094132360 12:27087910-27087932 TAGGATTGTAGAATAAAAAAAGG + Intergenic
1094181841 12:27599922-27599944 TAGGATTGTAGAATAAAAAAAGG + Intronic
1094194277 12:27730200-27730222 TGGGATTCTGGAACAGAAAAAGG - Intronic
1096017258 12:48288188-48288210 TGGGCTCCTAGAACAGAAAAAGG - Intergenic
1096916968 12:55043871-55043893 TAGGATCCTGAAATAGAAAAAGG + Intergenic
1097228502 12:57494960-57494982 TGGATTTGTAGAATAGAAAAGGG - Intronic
1097481999 12:60139991-60140013 TGGCATCCTGGAATAGTAAAAGG - Intergenic
1097723398 12:63048295-63048317 TAGGATCTTAAAAAAGAAAAAGG - Intergenic
1097729516 12:63112011-63112033 AGGGATCCTAGAATAGAAAATGG - Intergenic
1098025126 12:66193528-66193550 TGGGATCCTGGAACAGAGAAAGG - Intronic
1098135012 12:67392679-67392701 TGGGATGTTAGACTAAGAAAGGG + Intergenic
1098390260 12:69962142-69962164 TGGGATCTTGGAACTGGAAAAGG + Intergenic
1098637294 12:72800092-72800114 TCTGATTTTAGAATACAAAAGGG - Intergenic
1098731971 12:74047632-74047654 TAGGATCCTCAAATAGAAAAAGG + Intergenic
1098812337 12:75110558-75110580 GGAGATCTTGGAATAGGAAATGG + Intronic
1098821524 12:75236894-75236916 TGAGATCCTGGAATAGAAGAAGG - Intergenic
1099433050 12:82611154-82611176 TAGGATCTCAGAATAAAATAGGG + Intergenic
1100450878 12:94705491-94705513 TGGGACCTTGGGAGAGAAAAAGG - Intergenic
1100646779 12:96540019-96540041 TGGGACCTGAGATTATAAAACGG - Intronic
1100952930 12:99872681-99872703 TGGGATCTGTGAATACAAAAGGG - Intronic
1100975560 12:100118516-100118538 TGGGACCATGGAATAGAAAAAGG + Intronic
1101248502 12:102908779-102908801 TGGGATCCTAGAACAGACAAAGG - Intronic
1101635570 12:106537884-106537906 TGGGATTCTGGAACAGAAAAAGG + Intronic
1101974458 12:109343928-109343950 TGGGATCATGGAATAGAAAAAGG - Intergenic
1102659750 12:114515555-114515577 TGGGATCCCAGGACAGAAAAAGG + Intergenic
1102708770 12:114906770-114906792 TGAGATCCTAGAACAGAAAAAGG - Intergenic
1103309702 12:119994994-119995016 TGGTATCCTGGAACAGAAAAAGG - Intronic
1104022761 12:125004713-125004735 TGGGATCCTGGGACAGAAAAGGG - Intronic
1104080855 12:125429513-125429535 TGGGATCCTAGAACAGAAAGAGG - Intronic
1104115228 12:125743483-125743505 TGGGATCCTGGAGTAGAAAAAGG - Intergenic
1104124782 12:125835945-125835967 TGAGATCCCAGAACAGAAAAAGG - Intergenic
1104365949 12:128177497-128177519 TGAGATCCTAGAAGAGAAAGAGG + Intergenic
1105619934 13:22057000-22057022 TGGGATTCTGGAATGGAAAAAGG - Intergenic
1105696623 13:22895804-22895826 TGGGAGTTTAGAATAAGAAAGGG + Intergenic
1105806846 13:23956841-23956863 TGTGTTCTTAGAATGGAAAATGG + Intergenic
1105820010 13:24072156-24072178 TGTGTTCTTAGAATGTAAAATGG + Intronic
1106166358 13:27250316-27250338 TGGAATCCTGGAACAGAAAAAGG + Intergenic
1106414796 13:29537488-29537510 TGGGATCCTGGGACAGAAAAAGG + Intronic
1106432774 13:29697098-29697120 TGAGATCCTGGAACAGAAAAAGG - Intergenic
1106716386 13:32392822-32392844 TGGGATCCCAGAACAAAAAAGGG - Intronic
1106996091 13:35482547-35482569 TGGGATTTTAGATAATAAAATGG - Intronic
1107065242 13:36207655-36207677 TGGGATCCTGGGACAGAAAAAGG - Intronic
1107215326 13:37911109-37911131 TTGGAGCATAGAATATAAAAGGG + Intergenic
1107219570 13:37966266-37966288 TGGGATCCTGGAACTGAAAAAGG - Intergenic
1107699474 13:43033500-43033522 TGGGATCTTGGAACAGAAAAAGG - Intronic
1107796520 13:44058350-44058372 TGAGATCCTGGAACAGAAAAAGG + Intergenic
1109065609 13:57685736-57685758 TGGGATCCTAGAACACAAAAAGG + Intronic
1109080562 13:57894605-57894627 TAGGATCTTGGAATGGTAAACGG - Intergenic
1109650561 13:65319752-65319774 TGGGCACTTATAATAGATAAAGG + Intergenic
1109836542 13:67865538-67865560 TACCAACTTAGAATAGAAAATGG + Intergenic
1109880859 13:68474118-68474140 ATGGATCTTGGAATATAAAAGGG - Intergenic
1109983866 13:69949226-69949248 TGCGATCCTGGAACAGAAAAAGG - Intronic
1110111194 13:71748166-71748188 TGGGATCTGAAAAAAAAAAAAGG + Intronic
1110338406 13:74359964-74359986 TGGGATCCTAGAACAGAAAAAGG - Intergenic
1110440878 13:75523946-75523968 TGGGATCCTAGATCAGAAAAAGG + Intergenic
1110592209 13:77276370-77276392 TGTGATATTAGATTAAAAAAAGG + Intronic
1111068153 13:83124624-83124646 TGCCATCCTAGAATAGAGAATGG + Intergenic
1111095267 13:83505749-83505771 TGTGATCTTGGATTAGGAAATGG + Intergenic
1111325249 13:86685799-86685821 TTGGATCTTGGAACAGAATAAGG + Intergenic
1111528356 13:89503563-89503585 TTGGATCTTATAATATAAATCGG - Intergenic
1111775121 13:92651588-92651610 TGGGATCCTGGAACAGAAAGAGG + Intronic
1111776123 13:92664255-92664277 TGAGATATTAGAAAAGAAATTGG + Intronic
1111822527 13:93230311-93230333 TTCTATCCTAGAATAGAAAAGGG - Intronic
1112242936 13:97700214-97700236 TGTGATCTGAGAACTGAAAATGG + Intergenic
1113088928 13:106597143-106597165 TGGGATCCTAAAACAGATAAAGG - Intergenic
1113241937 13:108347740-108347762 TGGGATCCTGGAACAGAAAAAGG - Intergenic
1113356850 13:109589324-109589346 TGGGATTTATGACTAGAAAATGG + Intergenic
1114312737 14:21482450-21482472 TGGGATCAGAGAATGAAAAAAGG + Intronic
1114721151 14:24883411-24883433 TGGGATCCCAGAATAGATAGAGG - Intronic
1115123302 14:29962833-29962855 TTGGAAATTATAATAGAAAAAGG + Intronic
1115242832 14:31266590-31266612 TGGGATCCTGGAACAGAAAAAGG - Intergenic
1115268242 14:31524269-31524291 TAGCATTTTAGAACAGAAAAGGG + Intronic
1115828399 14:37304633-37304655 TGGCATCTTAGGATTGAACAAGG + Intronic
1116250329 14:42473837-42473859 TGGAATCCTAGAAGAAAAAAAGG - Intergenic
1116303224 14:43213710-43213732 TAGAATGTTAGAATACAAAAAGG + Intergenic
1117130075 14:52677534-52677556 TGGGATCCTAGAACAGGTAAAGG + Intronic
1117414604 14:55482258-55482280 TGGGATCCTGGAATAGAAAAGGG + Intergenic
1117502433 14:56366778-56366800 AGGAATCTTAGACTAGAAAAAGG + Intergenic
1117961113 14:61162699-61162721 TTAGATCTTAGAACAAAAAACGG + Intergenic
1117967894 14:61224419-61224441 TGGGGTCCTAGACCAGAAAAAGG - Intronic
1118362396 14:65067412-65067434 TGGGATCTTGGGACAGAAAAAGG - Intronic
1118445820 14:65850478-65850500 AGGTATCTTAGAAAAGAAAAAGG + Intergenic
1118507984 14:66436299-66436321 AGAGATCTAAGTATAGAAAACGG - Intergenic
1118547566 14:66908979-66909001 TGGGATCCTGAAACAGAAAAAGG + Intronic
1118709960 14:68510820-68510842 TAGGATCATTGAAAAGAAAAGGG + Intronic
1118882157 14:69838494-69838516 TGAGATCTTACAACAGAAAAAGG - Intergenic
1119122587 14:72092914-72092936 TGGGATCTTGGAATAGAAAAAGG - Intronic
1119656127 14:76418482-76418504 TGGGATCCTGGAAGAGAAAAAGG - Intronic
1120303345 14:82735967-82735989 TGTGATCTTAGTGTAGGAAATGG + Intergenic
1120375682 14:83703948-83703970 TGAGATCTTGGAATAGAAAAAGG + Intergenic
1120490186 14:85168050-85168072 TGGAATCCTGGAACAGAAAAAGG + Intergenic
1120698689 14:87673796-87673818 TGGGATCCTGGTACAGAAAAAGG - Intergenic
1120872012 14:89346316-89346338 TGGGATCCTGGAACAGAAAAAGG - Intronic
1120925054 14:89789335-89789357 TGGGATCCTAGAACAGGAAAAGG - Intergenic
1121218545 14:92267179-92267201 TGAGATCCTAGAACAGAACAAGG - Intergenic
1121351740 14:93178896-93178918 AGGGATCTTGGAACAGATAAAGG - Intergenic
1121572576 14:94958272-94958294 TGGGACCCTGGAAGAGAAAAGGG - Intergenic
1121979105 14:98438254-98438276 TGGAATCCTTGAGTAGAAAAAGG + Intergenic
1121984252 14:98486658-98486680 TGGAAACTTAGAAAAAAAAAGGG + Intergenic
1122184953 14:99984976-99984998 TGGGATCCTGGAACAGAAAAAGG - Intronic
1122208805 14:100161560-100161582 TGGGATCCTGGAGCAGAAAAAGG + Intergenic
1122567025 14:102666528-102666550 TGGGATTCTGGAACAGAAAAGGG - Intronic
1123806610 15:23880570-23880592 TGGGATCCTGGAATAAAAAATGG - Intergenic
1123812044 15:23937101-23937123 TGGGATCTTGAAATAGAAACTGG - Intergenic
1123814886 15:23967216-23967238 TGGGATCCTGGAATAATAAATGG - Intergenic
1123879309 15:24660581-24660603 TGGGAACCCAGAACAGAAAATGG - Intergenic
1123909009 15:24948585-24948607 TGAGATCCTGGAACAGAAAAAGG - Intronic
1123956545 15:25341861-25341883 TGGGATATTAGAATATCAAAAGG - Intronic
1123962689 15:25422451-25422473 TGAGAACTTAATATAGAAAAAGG + Intronic
1123993085 15:25698085-25698107 TGGGATCCCAGAACAAAAAAAGG + Intronic
1124588035 15:31027715-31027737 TGCAATCTTAGAATTGAACAGGG - Intronic
1124718190 15:32086612-32086634 TGGGATCGTGGAACAGAAACAGG - Intronic
1124902439 15:33836890-33836912 TGGAATCCTAGAACAGAAACAGG - Exonic
1124968876 15:34464300-34464322 TGGGATCCTGGAACAGAAAGAGG + Intergenic
1125037441 15:35142413-35142435 TGGCATATTAGAATAGACATGGG - Intergenic
1125099926 15:35900674-35900696 TAGGATCCTGGAATAGAAAAAGG - Intergenic
1125792233 15:42375860-42375882 TGGGATCTTGGAACAGAAAAAGG - Intronic
1125854374 15:42934943-42934965 TGAGATCCCAGAACAGAAAAAGG - Intergenic
1125968789 15:43895228-43895250 TGGGAAGTTAGAATGAAAAAAGG + Intronic
1126545813 15:49872803-49872825 TTGGATCCTAGAAGAGAAAAGGG + Intronic
1126951542 15:53887034-53887056 TGGAATCCTGGAACAGAAAAAGG + Intergenic
1127253978 15:57272172-57272194 TGGGATTTAATAATAGCAAATGG - Intronic
1127331862 15:57947689-57947711 TGTTATCTTAGAGAAGAAAAGGG + Intergenic
1127636390 15:60874706-60874728 TGGAAATTTAGAATTGAAAAAGG + Intronic
1127669635 15:61183028-61183050 TGGAATCCTAGAACAGAGAAAGG + Intronic
1128361704 15:66966310-66966332 TGGAATCTTGGAAGAGCAAAGGG - Intergenic
1128394095 15:67206062-67206084 TAGGATCTTGGAACAGAAAAAGG - Intronic
1128536059 15:68491494-68491516 TGGGATCCTGGAACAGAAAAAGG + Intergenic
1128590375 15:68890302-68890324 TGGGATCCTGGAACAGAAAAAGG - Intronic
1128773986 15:70304951-70304973 TTGGATCCCAGATTAGAAAAAGG - Intergenic
1128840292 15:70845233-70845255 TGGGATCCTGGAACGGAAAAAGG - Intronic
1128851623 15:70963491-70963513 TGGGATCCTGGAACAGAAAAAGG + Intronic
1129269649 15:74412768-74412790 TTGGATCCTAGAACAGAAGAAGG - Intronic
1130195420 15:81776046-81776068 TGCAACCTTAGAATAGAATATGG + Intergenic
1130680700 15:85993726-85993748 TGGGATGTTAGGGGAGAAAAGGG + Intergenic
1131213577 15:90518527-90518549 TGGGATCCTAGAAGAGAAAAAGG - Intergenic
1131898988 15:97067273-97067295 TGAGATCCTGGAACAGAAAAAGG + Intergenic
1132190401 15:99851099-99851121 TGGGATCCTGGAACAGAAAGAGG - Intergenic
1133169720 16:3974535-3974557 TGCATTCTTAGAATAGAAAGTGG - Intronic
1134268884 16:12716517-12716539 TGGAATCTTAAAGTAAAAAAAGG - Intronic
1134390447 16:13815241-13815263 TGGAATCCTGGAACAGAAAAAGG - Intergenic
1134518375 16:14905373-14905395 TGGTATCCTGGAACAGAAAAAGG + Intronic
1134555556 16:15160848-15160870 TGGTATCCTGGAACAGAAAAAGG - Intergenic
1134706046 16:16304026-16304048 TGGTATCCTGGAACAGAAAAAGG + Intergenic
1134961494 16:18408084-18408106 TGGTATCCTGGAACAGAAAAAGG - Intergenic
1134965794 16:18490687-18490709 TGGTATCCTGGAACAGAAAAAGG - Intronic
1135084103 16:19461051-19461073 CGAGATCCTGGAATAGAAAATGG + Intronic
1135661231 16:24298701-24298723 TGGGATCCTGGATCAGAAAAAGG - Intronic
1137846562 16:51695507-51695529 TAGGATCCTGGAACAGAAAAAGG + Intergenic
1138250408 16:55497862-55497884 TGGGATCCTAGAGAAGATAAAGG + Intronic
1138432810 16:56980182-56980204 TCAGATCTTGGAAAAGAAAAAGG - Intronic
1138641881 16:58394144-58394166 TGGAATCCTAGAATAGAAAAAGG - Intronic
1138925390 16:61583954-61583976 TTGGATCTTACAATATAAACTGG + Intergenic
1139015703 16:62686248-62686270 TGTAATCTTAGAATAGTTAAAGG - Intergenic
1139234687 16:65325281-65325303 TGGGATTCCAGAAGAGAAAAAGG - Intergenic
1139376792 16:66504096-66504118 TGGGCTCCTGGAATAGAGAAAGG - Intronic
1139765284 16:69223560-69223582 TGGGATCCTGGAACAGAAAAAGG - Intronic
1139789399 16:69420837-69420859 CTGGATCCTAGAACAGAAAAAGG - Intergenic
1140062705 16:71585067-71585089 TGGGATCTTGGAACAGAGAAAGG - Intergenic
1140132690 16:72177716-72177738 TCAGATCCTAGAACAGAAAAAGG - Intergenic
1140174942 16:72649028-72649050 TGCAATCTTGGAATAGAAAAAGG + Intergenic
1140482540 16:75269523-75269545 TGGAATCCCAGAACAGAAAAAGG - Intergenic
1140622666 16:76755051-76755073 TTGGATCCTGGAATAGAAAACGG - Intergenic
1140629595 16:76835332-76835354 TGGAATCCTAGGATAGAAAGAGG - Intergenic
1140946987 16:79777761-79777783 TTGGATCCTGGAATAGAGAAAGG - Intergenic
1141118374 16:81331353-81331375 TTGGATCCTAGAACAGAGAAAGG + Intronic
1141166619 16:81665076-81665098 TGGGATCCCAGAACAGAAAAGGG + Intronic
1141250216 16:82349247-82349269 TGGGATGTTAGACTAGTAAGAGG - Intergenic
1141307820 16:82882851-82882873 TGGGATATTAGGAGAAAAAAAGG + Intronic
1143945732 17:10590472-10590494 AGGGATATTGGAAAAGAAAAGGG - Intergenic
1144019328 17:11226115-11226137 GGGGGTCTTGGAACAGAAAAAGG + Intergenic
1144232139 17:13218204-13218226 TGGGATCCTGGAACAGAAAAAGG + Intergenic
1144313561 17:14037095-14037117 TTGAATCCTAGAGTAGAAAAAGG + Intergenic
1144655605 17:17033630-17033652 TGAGATCATGGAACAGAAAAAGG - Intergenic
1144824097 17:18095883-18095905 TGGGATCTCAGGACAGAAAAAGG - Intronic
1146934123 17:36800718-36800740 TGGGATCCTGGAATCGAGAAAGG - Intergenic
1147358260 17:39914430-39914452 TGGGATTCTGGAATAGAAAAAGG + Intronic
1147665705 17:42146228-42146250 TGGGATCCTGGAACAGCAAAAGG + Intronic
1148148120 17:45378889-45378911 TGGGGTCTCAGAATAGGAAGGGG + Intergenic
1148476851 17:47934279-47934301 TGGGGTCCTGGAACAGAAAAAGG + Intergenic
1148910048 17:50937289-50937311 TGGGATCCTGGAACAGAAAAAGG - Intergenic
1148975320 17:51522639-51522661 TGGGAACCTGGAAGAGAAAAAGG - Intergenic
1149619300 17:58030374-58030396 TGGGATCTTGGAACAGAAGAAGG + Intergenic
1149720828 17:58842304-58842326 TGGGATCCTGGAACAGAAAAAGG + Intronic
1149727809 17:58914322-58914344 TTGGATCCTAGAACAGAAAAAGG - Intronic
1149797951 17:59538832-59538854 TTAGATCCTAGAACAGAAAAGGG - Intergenic
1149999933 17:61427856-61427878 TGGAATCCTAGAACAGAAAAAGG + Intergenic
1150318542 17:64190309-64190331 TTGGATCCTGGAAGAGAAAAAGG + Intronic
1150647617 17:66989313-66989335 TGGGTTCTTATAAAAAAAAAAGG + Intronic
1150847050 17:68670075-68670097 TGGAAGCTAAGAATAGGAAAGGG + Intergenic
1150970364 17:70020383-70020405 TGGGATCCTGGAACAGAAAAAGG - Intergenic
1151031078 17:70739930-70739952 TTGTATCCTAGAACAGAAAAAGG + Intergenic
1151112668 17:71697470-71697492 TGGCATCCTAGAACAGAAAAAGG + Intergenic
1151179305 17:72314436-72314458 TGGGATCCTGGAATAGAAAAAGG - Intergenic
1151276755 17:73040441-73040463 TGGTATCTGAGAACAGAAGAAGG + Intronic
1152374178 17:79910323-79910345 TGAGATCCTGGAAAAGAAAAAGG - Intergenic
1152522949 17:80870943-80870965 TGGGATCCTGGGACAGAAAAAGG - Intronic
1153113466 18:1623092-1623114 TGGAATCTTGGAACAGAAAAAGG + Intergenic
1153429005 18:4994795-4994817 TGGGATCCTGGAACAGTAAAAGG - Intergenic
1153522325 18:5964509-5964531 TGGGCCCTTAGAAAAAAAAAAGG - Intronic
1153638893 18:7137885-7137907 TGGGATCCTAGAAGAGAAAAAGG - Intergenic
1153736246 18:8071434-8071456 GGGGACATTAGAATAGAAAAAGG - Intronic
1153856872 18:9158330-9158352 TGGGACCTTGGAACAGAAAAAGG - Intronic
1154328553 18:13410284-13410306 TGGGATCCTGGGATAGAAGAGGG + Intronic
1155194160 18:23457440-23457462 TGGGATCCTGGAACAGAAAAAGG + Intronic
1157089727 18:44623412-44623434 TGGGATATTAGAATGGGAGAGGG - Intergenic
1157200793 18:45657790-45657812 TTGGATGTTAGAATTGAAAAAGG - Intronic
1157399057 18:47371551-47371573 TGGGATTCTGGAACAGAAAAAGG - Intergenic
1157945738 18:51978498-51978520 TGGGATACTGGAACAGAAAAAGG + Intergenic
1158284532 18:55864585-55864607 TGGGAACTTGGAGAAGAAAATGG + Intergenic
1158711637 18:59842938-59842960 TGGCATCCTGGAAAAGAAAAAGG + Intergenic
1159812779 18:73036328-73036350 TGGGAGCCTGGAATAGAAAGAGG + Intergenic
1159978782 18:74751178-74751200 TGGGATCTTAAATTAGGCAATGG - Intronic
1161141061 19:2648068-2648090 TAGGATCCTAAAACAGAAAAAGG + Intronic
1162005556 19:7776309-7776331 TGGGATCTTGCCACAGAAAAAGG + Intergenic
1162616292 19:11803481-11803503 TTGGGTCCTGGAATAGAAAAAGG - Intronic
1163086294 19:14982158-14982180 TGAGATCCTAGAAAAGAAAAAGG + Intronic
1163950764 19:20583020-20583042 TGGAATTATAGAATAGAGAATGG + Intronic
1163967327 19:20759042-20759064 TGGAATTATAGAATAGAGAATGG - Intronic
1164775168 19:30847306-30847328 TGGGATCCTGGACTAGAAAAAGG + Intergenic
1165991502 19:39817706-39817728 TTGGATCCTGGAACAGAAAAAGG + Intergenic
1166580316 19:43892870-43892892 TGGGATCCTGGAAAAGAAAAAGG - Intronic
1167065279 19:47180961-47180983 TTGGATCTGAGAATAGAGGAAGG + Intronic
925760507 2:7179894-7179916 TGGGACCCTGGAAGAGAAAAGGG + Intergenic
925966086 2:9067507-9067529 TGGAATCCTGGAATAGAAACAGG - Intergenic
925996217 2:9295750-9295772 TGGAATGTTAAAAAAGAAAAAGG + Intronic
926028137 2:9562478-9562500 TTAGATCCTAGAACAGAAAAAGG - Intergenic
926397991 2:12465880-12465902 CAGGATCCTGGAATAGAAAAAGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926856691 2:17264195-17264217 TGGGATAATAAAAGAGAAAAAGG - Intergenic
927022632 2:19033273-19033295 TGGCATCATAGTAGAGAAAATGG + Intergenic
927062161 2:19433811-19433833 TGGGATCTTAGATCAGAAAAAGG - Intergenic
927101592 2:19791666-19791688 TTGGATCCTGGAACAGAAAAGGG - Intergenic
927554995 2:24024965-24024987 TGGGCTCTTGGGATACAAAAAGG - Intronic
927821402 2:26268709-26268731 TTGAATCTTGGAACAGAAAAAGG + Intronic
928031298 2:27782046-27782068 TGGGATCCTGGAACAGAAAAAGG - Intronic
928051398 2:28000196-28000218 TGGTATCCTAGAATAGAAAAAGG - Intronic
928911879 2:36430134-36430156 TGGTATTTTGAAATAGAAAAAGG + Intronic
929377323 2:41303855-41303877 CTGGATCTTGGAACAGAAAAAGG + Intergenic
929932297 2:46267866-46267888 TTGGATCCCAGAACAGAAAAAGG + Intergenic
931273687 2:60725328-60725350 TGGGATCTCAGGCTAGACAAAGG + Intergenic
931811253 2:65857073-65857095 TTGGATCTTGGAACAGAAAAAGG + Intergenic
931903037 2:66811665-66811687 TGAGATCCTGTAATAGAAAAAGG - Intergenic
932020377 2:68079289-68079311 TTTGATCCTAGAAGAGAAAAAGG + Intronic
932046992 2:68359516-68359538 TGGGATCCCAGAACAGAGAAAGG - Intergenic
932250806 2:70242002-70242024 TTGGATCCTAGAATATAAAAAGG + Intronic
932321479 2:70825321-70825343 TGGGATCCTAGGAGAGAAAAAGG + Intergenic
932361755 2:71114382-71114404 TGGGATCCTGGAATAGAAAAGGG + Intronic
932491526 2:72126038-72126060 TGGGATCTCAAAACAGGAAATGG - Intergenic
932921820 2:75924577-75924599 TTGGATCCTGGAAAAGAAAAAGG - Intergenic
933163845 2:79054348-79054370 TGGGATCTTGGCATTGATAAGGG - Intergenic
933414936 2:81975740-81975762 TGAAATCTTTGAAGAGAAAAAGG - Intergenic
933458485 2:82548114-82548136 TGGGGTCCTGGAACAGAAAAAGG - Intergenic
933797618 2:85932773-85932795 TGGAATCTTAGTACAGAAAAGGG - Intergenic
934029142 2:88025868-88025890 TTGTATTTTAGAATACAAAATGG + Intergenic
934063016 2:88313768-88313790 TGGGATCCTGAAATAGCAAAAGG + Intergenic
935005422 2:99070941-99070963 TGGGATCCTGGAATAGAAAAAGG - Intronic
935016146 2:99183826-99183848 TGGGATCCTGGAATAGCAAAAGG - Intronic
935441695 2:103105443-103105465 TGGGATCCTGGAACAGAAAAAGG - Intergenic
935694461 2:105759689-105759711 TGGGATCCTGGGACAGAAAAAGG - Intronic
935846472 2:107171277-107171299 TGGAATCCTGGGATAGAAAAAGG - Intergenic
935864899 2:107376383-107376405 TGGAATTCTGGAATAGAAAATGG + Intergenic
936051775 2:109229397-109229419 TGGGATCCTGGGACAGAAAAAGG - Intronic
936165007 2:110113706-110113728 TGGGATCCTGGACCAGAAAAAGG + Intronic
936490452 2:112966943-112966965 TTGGATCTTGAAACAGAAAAAGG - Intergenic
936663314 2:114566539-114566561 TTAGATCTTGGAACAGAAAAAGG - Intronic
936769742 2:115897420-115897442 TGGGATCCTGGAAGAGAAAAAGG + Intergenic
936869120 2:117111253-117111275 TGGGATCCTAGAACAGAAAAAGG - Intergenic
937507033 2:122549314-122549336 TGGGATCCTGGAAGGGAAAAAGG + Intergenic
937550989 2:123091556-123091578 TGGGATCCTAGAAAAGAAAGAGG - Intergenic
937571117 2:123363164-123363186 TGGGGTCTGAAAATATAAAATGG + Intergenic
937790493 2:125955851-125955873 TGGAATCCTAAAACAGAAAAAGG - Intergenic
938176888 2:129141957-129141979 AGGGATCTCAGAATTGAGAAAGG - Intergenic
938418278 2:131122779-131122801 TGTAGTCTTAGAATAGACAAAGG + Intronic
938581901 2:132654016-132654038 TAGGATCTTGGAACAGAAAAAGG + Intronic
938691427 2:133793154-133793176 TGAGTTCTGGGAATAGAAAAAGG - Intergenic
938845180 2:135201067-135201089 TGGGATCAGAGAATAGGAAGTGG - Intronic
939296121 2:140266595-140266617 AGGTAGCTGAGAATAGAAAAAGG - Intronic
939815601 2:146892886-146892908 TGGGGGCTTAGAGTTGAAAAGGG + Intergenic
940256833 2:151739910-151739932 TGGAATCTTGGAACAGAGAAAGG - Intergenic
940294346 2:152106722-152106744 TGGGATCCTGGAACAGAAAAAGG + Intergenic
940397829 2:153212781-153212803 TGGCTGCTCAGAATAGAAAATGG + Intergenic
940545390 2:155077074-155077096 TGGGATCCTGGAGTGGAAAAAGG - Intergenic
940899982 2:159117750-159117772 TCGGATACTGGAATAGAAAAAGG - Intronic
941129853 2:161634071-161634093 TTGTATCCTAGAACAGAAAATGG - Intronic
941411036 2:165157230-165157252 TGGGATCCTGGAACAAAAAAAGG - Intronic
941504488 2:166324898-166324920 TGAGATCTTGAAAGAGAAAAAGG + Intronic
941517854 2:166502262-166502284 TAGGATCCTAGAACAGAGAAAGG + Intergenic
941544270 2:166827873-166827895 TGATATCTTGTAATAGAAAAAGG + Intergenic
941576039 2:167231591-167231613 TTGGGTGGTAGAATAGAAAATGG - Intronic
941960861 2:171252237-171252259 CGGGATTCTGGAATAGAAAAAGG - Intergenic
942187729 2:173440252-173440274 TGAGATCCCAGAACAGAAAAGGG - Intergenic
942228661 2:173839073-173839095 TGGGATCTCGGAACAGAACAAGG - Intergenic
942242671 2:173977672-173977694 TTAGATCCTATAATAGAAAAAGG - Intergenic
943112775 2:183626115-183626137 TTGAATCCTAGAACAGAAAAAGG + Intergenic
943240161 2:185373959-185373981 TGGGATCCTTGAACAGAAATAGG + Intergenic
943469983 2:188282746-188282768 TGGAATTCTGGAATAGAAAAAGG + Intergenic
943502893 2:188713950-188713972 TGGGATCCTGGAACAGGAAAAGG - Intergenic
943752987 2:191529264-191529286 TGGGATCTTAGAATAAAATTTGG + Intergenic
943971971 2:194421802-194421824 TGGAATCCTAAAATAGAACAAGG + Intergenic
944120603 2:196236544-196236566 TGGGATCATGGAACAGATAAGGG - Intronic
944332591 2:198489054-198489076 TGGGGTCCTAGAACAGAAAAGGG - Intronic
945268139 2:207911514-207911536 TTGGATCTTGGAACAGCAAAAGG - Intronic
945513352 2:210730122-210730144 TGAGTACTTAGAATAGAAAGTGG - Intergenic
946183433 2:217962847-217962869 TTGGATCCTAGATCAGAAAAAGG + Intronic
946216064 2:218184521-218184543 TTGGATCCTGGAATAGAAAGAGG + Intergenic
947089938 2:226498344-226498366 TGGAATCATACAATAGGAAAAGG + Intergenic
947312567 2:228820379-228820401 AGGGATCCTGGAACAGAAAAAGG - Intergenic
947692019 2:232147456-232147478 TGAGATCCTGGAATAGATAAAGG - Intronic
947786865 2:232830661-232830683 TGGAATCCTGGAACAGAAAAAGG - Intronic
947859919 2:233351550-233351572 TGGGATCCCAGAACAGAAAAAGG - Intergenic
947889968 2:233608903-233608925 TGGGATCCCAGAAAAGAACAAGG - Intergenic
947894686 2:233658442-233658464 TGGGATCCTAGAAATGAAAAAGG - Intronic
947895602 2:233668812-233668834 TGGGATCCCAGAAAAGAACAAGG - Intronic
947923576 2:233901307-233901329 TTGTATCTTAGAATGAAAAAGGG + Intergenic
948020572 2:234729994-234730016 TGGGATCTGTGAATAGCACAAGG - Intergenic
948342161 2:237262402-237262424 CAGGATCCTAGAACAGAAAAAGG + Intergenic
948457063 2:238109784-238109806 TGGGATCCTGGGATAGAAAAGGG - Intronic
948457073 2:238109834-238109856 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457083 2:238109884-238109906 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457095 2:238109934-238109956 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457106 2:238109984-238110006 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457116 2:238110034-238110056 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457126 2:238110084-238110106 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457136 2:238110134-238110156 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457147 2:238110184-238110206 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457158 2:238110234-238110256 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457181 2:238110335-238110357 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457204 2:238110447-238110469 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457214 2:238110497-238110519 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457236 2:238110597-238110619 TGGGATCCTGGGACAGAAAAGGG - Intronic
948457268 2:238110747-238110769 TGGGATCCTGGGACAGAAAAGGG - Intronic
1168833768 20:862841-862863 TGGGATCCTGGAACAGAAAAGGG - Intergenic
1168952735 20:1813615-1813637 TGGGAGCTTAAAATCTAAAAGGG + Intergenic
1169136127 20:3198802-3198824 TGGGACCCTGGAAAAGAAAAAGG + Intronic
1169167849 20:3439932-3439954 TTGGATCTTGGAACAGAAAAGGG + Intergenic
1169192052 20:3664116-3664138 ATGGATCTTGGAACAGAAAAAGG - Intergenic
1169271941 20:4207313-4207335 TGGTATTCTAGAAGAGAAAAAGG - Intergenic
1169307169 20:4502004-4502026 TGTGTTCTAAGAAGAGAAAATGG + Intergenic
1169566821 20:6863674-6863696 TGGAAACTTAAGATAGAAAAAGG - Intergenic
1169813839 20:9635650-9635672 TGAGAACTTAGAAATGAAAAGGG + Intronic
1170015464 20:11776340-11776362 TGGGATCTTGAAACAGAAAAAGG + Intergenic
1170194069 20:13672780-13672802 TGGGATCTGGGACCAGAAAAGGG - Intergenic
1170435183 20:16319168-16319190 TGGGATCCTGGAACAGAAAAAGG + Intronic
1170548760 20:17457393-17457415 TTGGTTCCTAGAATAGAAAGGGG + Intronic
1170598632 20:17823893-17823915 TTGGACCTAAGAATAGAAACTGG + Intergenic
1170729863 20:18964158-18964180 TGGGATCCTGGAACAGAACAAGG - Intergenic
1171331353 20:24341461-24341483 TGGGCTCCTGGAACAGAAAAGGG + Intergenic
1171368268 20:24642079-24642101 TGGGACCTTGGAACAGAAAAAGG - Intronic
1171980121 20:31621928-31621950 TTGGATCCCAGAACAGAAAAAGG + Intergenic
1172542896 20:35735386-35735408 TAGTATCCTAGAATAGTAAAAGG - Intronic
1172544589 20:35749692-35749714 TGGGATTTTTATATAGAAAAAGG - Intergenic
1173283972 20:41654132-41654154 TGGAATCTAAGGATAGAGAATGG + Intergenic
1175643983 20:60655932-60655954 ATGGATCCTGGAATAGAAAAAGG - Intergenic
1176414089 21:6465013-6465035 TGGGATCCTGGAATAGAAAAGGG + Intergenic
1176658083 21:9606092-9606114 TTGGATCCTTGAATAGGAAAAGG + Intergenic
1176959628 21:15144574-15144596 TGAGATCATGGAACAGAAAAAGG + Intergenic
1177179875 21:17733720-17733742 TTGGATCCTGGAAGAGAAAAAGG - Intergenic
1177484491 21:21739650-21739672 TGGGATCAAATAATAGACAATGG - Intergenic
1177787530 21:25687972-25687994 TGGGATCTTACAATTTAACAGGG - Intronic
1178386523 21:32155546-32155568 TTGTATGTTAGAACAGAAAAAGG + Intergenic
1178479327 21:32966104-32966126 TTGGGTCTTGGAATAGAAAAAGG - Intergenic
1178779170 21:35584241-35584263 AGAAATCTTAGAATGGAAAAAGG + Intronic
1178951872 21:36991888-36991910 TGGGATCCTGGAACAGAAAAAGG + Intergenic
1179074432 21:38106714-38106736 CATGATCTTAGAATAGACAATGG + Intronic
1179244558 21:39620177-39620199 TGGGATCCTGGACCAGAAAAAGG - Intronic
1179689587 21:43073335-43073357 TGGGATCCTGGAATAGAAAAGGG + Exonic
1180735093 22:18010626-18010648 TGGGAGCTAAGAAAAGAAAAGGG - Intronic
1181081820 22:20420586-20420608 CGGGGTCTTAGAATGGACAAGGG + Intergenic
1182129677 22:27841829-27841851 TGGGAACTGAGAACAGAAAAGGG + Intergenic
1182174112 22:28265773-28265795 AAAGATCTTAGAACAGAAAATGG + Intronic
1182327777 22:29526916-29526938 TTGGATCTTGGGACAGAAAAAGG + Intronic
1182995884 22:34812051-34812073 TGGAATCCTAGAACAGAGAAAGG + Intergenic
1183019440 22:35015456-35015478 TTGGATCCTGGAAGAGAAAAAGG + Intergenic
1183877637 22:40797583-40797605 CAGGTTCTTAGATTAGAAAATGG + Intronic
1184456487 22:44613270-44613292 TGGGATCTTGGATCAGAAAAAGG + Intergenic
949142449 3:651192-651214 AGGGAACTTAGAAAAGACAAAGG - Intergenic
949697876 3:6720290-6720312 TGAGATCCTAGAACAGAAAAAGG + Intergenic
949868197 3:8564043-8564065 TGGGATCCTGGAATAGAAAAAGG + Intronic
949968801 3:9384214-9384236 TGGGATCCAAGAAGAGAAACTGG + Exonic
950616220 3:14160681-14160703 TGGTATCATGGAACAGAAAAAGG + Intronic
951108003 3:18768397-18768419 TTGAATCTTATAATAGAAATTGG + Intergenic
951659536 3:25047235-25047257 TGGGAGATTAGAATGGCAAATGG + Intergenic
951942277 3:28092743-28092765 TGGGAACTTGGGACAGAAAAAGG - Intergenic
953227825 3:41036492-41036514 TGGGATCCTGGGACAGAAAAAGG - Intergenic
953323683 3:41994648-41994670 TGGGATCCTGGAACAGAAAAAGG - Intergenic
953409262 3:42680525-42680547 TGGGATCTTAGGGTTGACAATGG - Intergenic
953665067 3:44919628-44919650 TGGGATCCTGGAACAGAAAAGGG + Intronic
953695712 3:45157196-45157218 TGGGATCTTGAAACAGAAAGAGG - Intergenic
953984557 3:47431450-47431472 TGGGATCCTGGAAAAGAAAAAGG - Intronic
954056725 3:48032188-48032210 TGAGATCCTAGAACAGAAAAAGG + Intronic
954087080 3:48253415-48253437 TGGGATTTTGGGACAGAAAATGG - Intronic
955400746 3:58589734-58589756 AGGGATCCTGGAACAGAAAAGGG - Intronic
955439361 3:58939334-58939356 TGGGATTCTAGAAAGGAAAAGGG + Intronic
955562447 3:60206276-60206298 CTGGATCTTAGAAGAGCAAAGGG - Intronic
956055276 3:65291915-65291937 TGGGAAGTTATACTAGAAAAGGG - Intergenic
956754848 3:72374308-72374330 TGGGATTTAAGGAAAGAAAATGG - Exonic
956803345 3:72783917-72783939 TGGTCTCATAGAAGAGAAAAAGG + Intronic
957287596 3:78236597-78236619 TAGGATTTTAGAAGATAAAATGG - Intergenic
957828790 3:85487857-85487879 TTGTATCTTAGAAAAGAATAAGG - Intronic
957886616 3:86296667-86296689 TGGGATCAGAGAATAGGCAATGG - Intergenic
958110914 3:89143780-89143802 TTGGATCCTGGAACAGAAAAAGG - Intronic
958443858 3:94190952-94190974 TTGAATCTTGGATTAGAAAATGG - Intergenic
959729791 3:109588868-109588890 GGGCATCTCAGTATAGAAAAAGG + Intergenic
959829123 3:110839421-110839443 TTGGATCCAAGAAAAGAAAAAGG + Intergenic
960537179 3:118827098-118827120 TGTGGTCATACAATAGAAAAGGG - Intergenic
961181311 3:124880231-124880253 TGGGATCCTAGAACAGAAAAAGG + Intronic
961267433 3:125655201-125655223 ATGGATCTTGGAACAGAAAAAGG - Intergenic
961604074 3:128080768-128080790 TGGGATCCTGGGACAGAAAAAGG + Intronic
961934946 3:130573367-130573389 TGGCATCTCAGAAAATAAAATGG + Intronic
961945835 3:130686757-130686779 TTGGATCCTGGAATAGTAAAAGG - Intronic
962845255 3:139268236-139268258 GGGGATGTTAGAATGGAAAGAGG - Intronic
963203404 3:142607698-142607720 TGGGATCCTGGAACAGAAAAGGG - Intronic
963374130 3:144441382-144441404 TGAGATCCTGGAAGAGAAAAGGG + Intergenic
963702387 3:148642455-148642477 AAGTATATTAGAATAGAAAATGG + Intergenic
963766407 3:149340654-149340676 GGGGAACTTTGAATAGAAACAGG - Intergenic
963872086 3:150428049-150428071 TTGGATCCTGGAACAGAAAAAGG - Intronic
963907530 3:150785218-150785240 TGGAATCCTGGAACAGAAAAAGG - Intergenic
964019005 3:151984422-151984444 AGTGATCTTAAAATAGTAAACGG + Intergenic
964203960 3:154149734-154149756 TTAGATCTTAGAACTGAAAAAGG + Intronic
964366083 3:155952150-155952172 TGGGATCCTAGAACAGAAAAAGG - Intergenic
964661533 3:159125384-159125406 TGGGATCTTAGAGCAGAAAATGG + Intronic
964874532 3:161351126-161351148 TGGAATCCTGGAACAGAAAAGGG + Intronic
965134607 3:164745928-164745950 TGGGCTCTTGGGATAGCAAAAGG + Intergenic
965135312 3:164758529-164758551 TGGGATGTTATATTAGAAAATGG + Intergenic
965269121 3:166589871-166589893 TGAGATCTTAGGACAGAAAAGGG + Intergenic
966205696 3:177403942-177403964 TTGGATCCTGGAATAGAAAGAGG + Intergenic
966225724 3:177595849-177595871 TGGGATATCAGAGGAGAAAATGG - Intergenic
966379738 3:179332094-179332116 TGGTATCCTGGAACAGAAAAGGG + Intronic
967368498 3:188715457-188715479 TCAGAGCTTATAATAGAAAATGG + Intronic
968203588 3:196778684-196778706 TTGGATCCTGGAACAGAAAAGGG - Intronic
968256457 3:197277681-197277703 TGGGATATTTCAGTAGAAAAGGG - Intronic
970461849 4:16282576-16282598 TGGCAGCTTAGAATAGAAGAAGG + Intergenic
970929027 4:21487139-21487161 TGGGATCCTGGAACAGAAAAGGG - Intronic
971142877 4:23944034-23944056 TGGGATCCTGGAATAGAAAAAGG + Intergenic
971164513 4:24169335-24169357 TGGGATCCCAGAACAGAAAAAGG + Intergenic
971584916 4:28393344-28393366 TGAGATCCTGGAACAGAAAAGGG + Exonic
971790814 4:31167870-31167892 TGGTAATTTGGAATAGAAAAAGG - Intergenic
971981893 4:33762451-33762473 TAAGATGTTAGAACAGAAAAAGG + Intergenic
972141342 4:35963617-35963639 TGGGATCTTGGAACAGAAAACGG + Intronic
972172470 4:36363281-36363303 TGGGATCCTAGAAGATAAAAAGG + Intergenic
972221156 4:36956920-36956942 TGGTATCCTAGAATAGAAAAAGG - Intergenic
972439040 4:39067122-39067144 TAGGATCCTCGAACAGAAAAAGG - Intronic
972681526 4:41311062-41311084 TTGGATCCTAGAATACAGAAAGG + Intergenic
972962589 4:44472375-44472397 TGGGATTCTGGAACAGAAAAAGG + Intergenic
973660776 4:53104497-53104519 TGGAATCCTAGAACAGAATAAGG + Intronic
973664974 4:53149964-53149986 TGGCCTCTTGGAATAGTAAAAGG + Intronic
973794214 4:54407304-54407326 TGGGATCCTTGAACAGAAAAAGG + Intergenic
974662260 4:64907411-64907433 TGGGATCCTTGACAAGAAAAAGG - Intergenic
974699560 4:65422991-65423013 TGGAATCTCAGGACAGAAAAAGG - Intronic
974818214 4:67033434-67033456 TGGGAATTTATAACAGAAAATGG + Intergenic
975234286 4:71973209-71973231 TGGGATCCTAGAAGAGAAGAAGG - Intergenic
975283102 4:72586091-72586113 TGGGATCCTGGAACAGAAAAAGG - Intergenic
975328709 4:73089509-73089531 TTAGATCCTACAATAGAAAAAGG + Intronic
975663845 4:76714247-76714269 TGGGATCCTAGAACAGAAACAGG - Intronic
976515015 4:85955161-85955183 TTGGATTTTAAAACAGAAAAGGG - Intronic
976802127 4:89004636-89004658 AGGGAAGTTAGAATAGAGAAAGG + Intronic
977187907 4:93963184-93963206 TGGGATCCTGGAATAGATATAGG + Intergenic
977363446 4:96035826-96035848 TAGCATCTTAGGATAGAATAAGG + Intergenic
977859567 4:101940499-101940521 TGGGACCTTGAAACAGAAAAAGG - Intronic
977860368 4:101951038-101951060 TGGAACCTTGGAACAGAAAAAGG + Intronic
978035071 4:103982746-103982768 AAGTATCTTAAAATAGAAAAGGG + Intergenic
978253085 4:106657090-106657112 TGGAATCCTGGAATACAAAAAGG - Intergenic
978266654 4:106834930-106834952 TGGGATCCTGGAACAGAAAAAGG - Intergenic
978267377 4:106842543-106842565 TGAGATATTATCATAGAAAAAGG + Intergenic
978329854 4:107600603-107600625 TGTAATCTTAGAACAGAATAAGG - Intronic
978556155 4:109982711-109982733 TGGTGTCTTAGTATGGAAAAAGG - Intronic
978614966 4:110585259-110585281 TGGGATCCTCGAACAGAAAAAGG + Intergenic
978815350 4:112898280-112898302 TGGTATCCTAGAAGAGAAAAGGG - Intronic
978952187 4:114574208-114574230 TGGGATCCAAGAACAGAAAAAGG - Intergenic
978984375 4:114992176-114992198 TGGGATCCTGGAACAGAAAAAGG - Intronic
979101935 4:116628583-116628605 TAATACCTTAGAATAGAAAAAGG - Intergenic
979364045 4:119798999-119799021 TGGGATGTTAGATCAGAAAGAGG + Intergenic
979464302 4:121018630-121018652 TGGGATCCTGGAAAGGAAAAAGG - Intergenic
979627388 4:122860869-122860891 TTGGATCTCGGAACAGAAAAAGG - Intronic
980319737 4:131255597-131255619 AGGGATATTAGTTTAGAAAATGG - Intergenic
980735647 4:136883826-136883848 TGGGATCTTAGAGGAAAAAGAGG - Intergenic
980966641 4:139527802-139527824 TTGGATCCTGGAAGAGAAAAAGG - Intronic
981101192 4:140831049-140831071 TGGGATCCTATAACAGAAAAGGG - Intergenic
981567927 4:146120290-146120312 TGGCATCCTGGAACAGAAAAAGG + Intergenic
982177158 4:152716576-152716598 TGGAATCCTGGAACAGAAAAAGG - Intronic
982306941 4:153942442-153942464 TGGGATTTTAGAGTAGAAGCTGG - Intergenic
982387513 4:154826519-154826541 TTGGATGTTAGAAAAGTAAATGG + Intronic
982678998 4:158407733-158407755 GGGGATATTAGGATAGAAAAAGG - Intronic
982752885 4:159183487-159183509 TGGGATCTTGGATTAGGTAATGG + Intronic
982790134 4:159582013-159582035 TAGGATTTTAGAATGGAAAGTGG + Intergenic
982797356 4:159662397-159662419 TGGGATATTAGGAAGGAAAAAGG - Intergenic
983152158 4:164297611-164297633 TGGGATTGTGGATTAGAAAAAGG + Intronic
983415360 4:167445136-167445158 TGGAATCATAGAATACAAAGTGG + Intergenic
983884208 4:172962424-172962446 TTGGATCCTGGAACAGAAAAAGG - Intronic
984027050 4:174555480-174555502 TGGGATCTTGGAACAGAAGAAGG - Intergenic
984056700 4:174939267-174939289 TGGGCTCTTAGAAAAGGAAATGG - Intronic
984946242 4:184970751-184970773 TGGGGTCCTGGAACAGAAAAGGG + Intergenic
985054590 4:186025357-186025379 TGGGATCTTGAAACAGAAACAGG + Intergenic
985417326 4:189749981-189750003 TTGGATCCTTGAATAGGAAAAGG - Intergenic
985527961 5:416626-416648 TGGGATCTGAGCACAGAAGATGG - Intronic
986134733 5:4965700-4965722 TGGAATCCTGGAATATAAAAAGG + Intergenic
986390245 5:7278845-7278867 TGGGATCTTGGAAAAGCATAGGG - Intergenic
986585929 5:9318561-9318583 TTGGATCTTAGAGTACAAAGAGG + Intronic
986713894 5:10508477-10508499 TTGTATCCTGGAATAGAAAAAGG - Intronic
986718595 5:10541735-10541757 TGGGATCCTGGAACAGAAAATGG + Intergenic
987342976 5:16954735-16954757 TGGGATCTTGGAACAGAAAAAGG + Intergenic
987652218 5:20757231-20757253 TAGGATCTCAAAACAGAAAAGGG - Intergenic
987835512 5:23155628-23155650 AGGGATCTTAGAATAAGAGAAGG - Intergenic
987989036 5:25186672-25186694 TGGAATCTTAAAAAAGAAATTGG + Intergenic
988357120 5:30192396-30192418 TTCAATCTCAGAATAGAAAAAGG - Intergenic
988701508 5:33679600-33679622 TGGGATTTTAGAAAATAAAAAGG - Intronic
988743347 5:34104249-34104271 TAGGATCTCAAAACAGAAAAGGG + Intronic
988775417 5:34473941-34473963 TGGGATCCTGGAACAGAAAAAGG + Intergenic
988820634 5:34881438-34881460 TGGGATCTTATGACAGACAAAGG - Intronic
989380976 5:40809250-40809272 TGGGATCCTAGAACAAAAAAAGG - Intergenic
989798964 5:45511741-45511763 TGGGATCCCAGAAGAGAAAGAGG + Intronic
990441282 5:55847766-55847788 TTGGATCCTGGAACAGAAAAAGG - Intergenic
990639801 5:57769946-57769968 TGGGATTCTGGAACAGAAAAAGG - Intergenic
990934665 5:61135244-61135266 TGGCTCCTTAGAATAGAAAATGG - Intronic
991134614 5:63166881-63166903 TTGGGGCTTAGAAGAGAAAATGG - Intergenic
991584100 5:68185379-68185401 TGGGATCCTGGAGTGGAAAAAGG + Intergenic
992122148 5:73605808-73605830 TTGGATCCTAAAACAGAAAAAGG - Intergenic
992141777 5:73804607-73804629 TGGGATCCTGGAATAGAAAACGG - Intronic
992340411 5:75817416-75817438 TGGGATCCTGGAACAGAAAGAGG + Intergenic
993060532 5:83033303-83033325 TGGGAACTTGGAACAGAAAAAGG + Intergenic
993173759 5:84455281-84455303 TAGGATCCTGGAAGAGAAAAAGG - Intergenic
993497519 5:88624025-88624047 TGGGATCCTAGAACAGATAAAGG + Intergenic
993564542 5:89457176-89457198 TTGGATTTTAAAATAGAAAAGGG + Intergenic
993637309 5:90360254-90360276 TGGTATCTCAGAAGAGGAAAGGG + Intergenic
993779208 5:92044860-92044882 ATGGATCCTAGAACAGAAAAGGG - Intergenic
995042696 5:107607237-107607259 TGATACATTAGAATAGAAAATGG + Intronic
995168135 5:109072239-109072261 TGCGAGCATAGAATAGAAAGAGG - Intronic
995436298 5:112139782-112139804 TTGGATCCTAAAACAGAAAAGGG + Intergenic
995807637 5:116071300-116071322 TGGGATCCTGGAACACAAAAAGG - Intergenic
995883590 5:116869042-116869064 TGGGATCCTGGAACAGAAAAAGG - Intergenic
996028598 5:118680018-118680040 TTGACTCTTAGAAAAGAAAAGGG - Intergenic
996199436 5:120652734-120652756 TGGGATCGTGCAACAGAAAAGGG + Intronic
996338278 5:122408418-122408440 TGGGCTCCAAGAATGGAAAATGG + Intronic
996352420 5:122560061-122560083 TGGGATCCAAGAAGAAAAAAGGG - Intergenic
996810133 5:127507297-127507319 TGAGATCCTGGAACAGAAAAAGG - Intergenic
996887169 5:128371211-128371233 TGGGGTCTTTGAACAGGAAAAGG - Intronic
996948950 5:129101753-129101775 TTGGATTTTGGAACAGAAAAAGG - Intronic
997218747 5:132138751-132138773 TTGGATCCTAGAACAAAAAAAGG + Intergenic
997240048 5:132299971-132299993 TGGGATCCTACGATAGAAAAAGG - Intronic
997779965 5:136647094-136647116 TGGGATCTTGGAATGCATAATGG - Intergenic
998271246 5:140708574-140708596 TGGCATCTTGGAAAAGTAAATGG + Intergenic
998304305 5:141058187-141058209 TTGGATCCTTGAATAGAAAAAGG - Intergenic
998362408 5:141600351-141600373 TGGGATCTCAGAATATCACAAGG - Intronic
998436927 5:142118225-142118247 TGGGATCCTGGAACAGAAAAAGG - Intronic
998677027 5:144420986-144421008 TGAGATACTAGAATAGAAAGAGG - Intronic
998900516 5:146848364-146848386 TAGGATCCTAGAGTAGAAAAAGG - Intronic
999463327 5:151776053-151776075 CTGGATCCTAGAACAGAAAAAGG - Intronic
1000022967 5:157334815-157334837 TTGAATCTTAGAACAGAAAAAGG + Intronic
1000169866 5:158691462-158691484 TGGAAACTTAGAATAGAGCAGGG + Intergenic
1000457245 5:161465964-161465986 TTGGATCCTTGAACAGAAAAAGG - Intronic
1000600180 5:163264294-163264316 TGGGATCCTGGAACAGACAAAGG + Intergenic
1000670505 5:164056701-164056723 TGGGATTTTGGAGAAGAAAAAGG + Intergenic
1000787709 5:165566689-165566711 TGCGATCCTGGAGTAGAAAAGGG - Intergenic
1001063427 5:168514746-168514768 CTGGATCTTAGACTAGAAAAAGG - Intronic
1001235718 5:170027722-170027744 TGGGATCTGGGAATGCAAAATGG - Intronic
1001319105 5:170665676-170665698 TGGGATCCTGAACTAGAAAAAGG - Intronic
1001466716 5:171973602-171973624 TGAGATCATAGACCAGAAAAAGG + Intronic
1001685225 5:173589609-173589631 TGGGATCCTGGAACAGAAAAAGG - Intergenic
1001794140 5:174487931-174487953 TGAGATCCTGGAAGAGAAAAAGG + Intergenic
1002210778 5:177597850-177597872 TGGAATCCTGGAACAGAAAAAGG - Intergenic
1003047972 6:2752413-2752435 TGGGATTCTGGAACAGAAAAGGG - Intergenic
1003485837 6:6578673-6578695 TTTGATTTTATAATAGAAAATGG + Intergenic
1003694827 6:8393908-8393930 TTGGATCCTGGAACAGAAAAAGG - Intergenic
1003747028 6:9013698-9013720 TGGGATCCTGGAAAAGAAAAAGG + Intergenic
1003783533 6:9456723-9456745 TGAGATATTAGAATAGCAAAGGG - Intergenic
1004665873 6:17748154-17748176 TGGGATCCTGGAACAGAAAAAGG - Intergenic
1004777364 6:18862968-18862990 TGGGATCCTGGAACAGAAAAAGG - Intergenic
1004799379 6:19129342-19129364 TGAGATTTTGGAATAGCAAAAGG + Intergenic
1004867939 6:19872367-19872389 AGGGATCCTAGAACAGAAAAAGG - Intergenic
1004946592 6:20620946-20620968 TGGCATCCTGGAAAAGAAAAGGG - Intronic
1005176890 6:23057157-23057179 TGGGATACTGGAATAGAAAAGGG - Intergenic
1005431909 6:25766904-25766926 TGGGATTCTGGAACAGAAAAAGG + Intronic
1005523473 6:26622399-26622421 TTGGATCTTGGAACATAAAAAGG - Intergenic
1005654931 6:27925983-27926005 TGAGATCCTGGAATAGTAAAAGG - Intergenic
1006110359 6:31740651-31740673 TGGGAAGTTAGAATAAAAGAGGG + Intronic
1006766072 6:36508326-36508348 TGAGAGCTAAGAATTGAAAATGG - Intronic
1007117768 6:39355994-39356016 TGGGAGCCTGGAACAGAAAAAGG - Intronic
1007307898 6:40921473-40921495 AGGGCTCTGAGAACAGAAAAGGG - Intergenic
1007488788 6:42201649-42201671 TGGGATTTTAGAACTGGAAAAGG + Intergenic
1007832546 6:44649670-44649692 TGGGATCCTGGAACAGAAAAAGG + Intergenic
1008209912 6:48708818-48708840 TGAGGTCATAGAATAGAAAGAGG - Intergenic
1008396256 6:51011135-51011157 TGAGATCTCAGAACAGAAAAAGG - Intergenic
1009244289 6:61216486-61216508 TGGGATTCTGGAACAGAAAATGG - Intergenic
1009578687 6:65502612-65502634 TAGGATCCTAGAAAAGAAAAGGG - Intronic
1009828535 6:68898967-68898989 TGAGATATTAGAACAGAAAAAGG + Intronic
1009888424 6:69652613-69652635 TAGGATGTTTGAGTAGAAAATGG - Intergenic
1010064743 6:71669089-71669111 TAGGATCCTGGAACAGAAAAAGG - Intergenic
1010145763 6:72667987-72668009 TTGGATCTTGGAACAGAATAAGG + Intronic
1010219376 6:73434594-73434616 TGGGATCTTGGAACAGTAAAAGG + Intronic
1010309839 6:74372097-74372119 TGGGATCCTCAAATAGAAAAAGG + Intergenic
1010813369 6:80325971-80325993 TGGGATCCCAGAGTGGAAAAAGG + Intronic
1011156801 6:84342082-84342104 TGGGATCCTGGGACAGAAAAAGG + Intergenic
1011258476 6:85448620-85448642 TTGGGTCCTGGAATAGAAAACGG + Intergenic
1011425325 6:87222754-87222776 TGGAATCCTGGAATAGAAAAAGG - Intronic
1011571257 6:88738363-88738385 TGGGATCCTGGAAAAGAAAAAGG + Intronic
1012166358 6:95957972-95957994 TGGGAATTTATAATATAAAATGG - Intergenic
1012278625 6:97302669-97302691 TGGGACCCTTGAACAGAAAAAGG - Intergenic
1012289566 6:97436141-97436163 TGGGACATTATAACAGAAAAAGG + Intergenic
1012457540 6:99424191-99424213 TGGCATCCTGGAACAGAAAAAGG + Intronic
1012511376 6:100005826-100005848 TGAGATCCTGGAACAGAAAAAGG + Intergenic
1012531371 6:100241534-100241556 GGGGAATTTAGAGTAGAAAATGG + Intergenic
1013000599 6:106018478-106018500 TGTAATCCTGGAATAGAAAAAGG - Intergenic
1013145824 6:107390536-107390558 TTGGATCCTGGAACAGAAAAAGG + Intronic
1013283060 6:108656852-108656874 TTGTATCTTGCAATAGAAAACGG + Intronic
1013545870 6:111156689-111156711 TGGGATCTTGGAATAGAAAAAGG + Intronic
1013676907 6:112474880-112474902 TTCCATCTTAGTATAGAAAATGG - Intergenic
1014249958 6:119105093-119105115 TGGGATCCTGGAACAGAAAAAGG + Intronic
1014681599 6:124437669-124437691 TAGAAACTTAGAATAGAAACTGG + Intronic
1014751718 6:125264489-125264511 TGGAATCTTAGCAGAGAGAATGG + Intronic
1015532946 6:134239554-134239576 TGGGATGTTAGAACTAAAAAGGG - Intronic
1016164453 6:140922973-140922995 TGGGATTTTAGGACAGAAAAAGG - Intergenic
1016194154 6:141311518-141311540 TGGGATCCTGGAACAGAAACGGG + Intergenic
1016224595 6:141720168-141720190 AGGGGACTGAGAATAGAAAATGG + Intergenic
1016434847 6:144025355-144025377 AGGAATCCTGGAATAGAAAAAGG + Intronic
1016447455 6:144148657-144148679 TGGGATCCTGGGACAGAAAAAGG - Intergenic
1016865101 6:148758602-148758624 TGGGAACTGAGAAAAGAAAGTGG - Intronic
1017023356 6:150159843-150159865 TGGGATCCTGGAACAGAAAAAGG - Intronic
1017203808 6:151783784-151783806 TGGGATACTGGAATAGAAAACGG - Intronic
1017295716 6:152791339-152791361 TTGGATCCTGGAATAGAAAAAGG - Intergenic
1017313874 6:153005821-153005843 TGGGATCCTGGGACAGAAAAAGG + Exonic
1017504631 6:155056844-155056866 TGGGCTCCTGGAACAGAAAAAGG - Intronic
1020435601 7:8159167-8159189 TTGGATCCTGGAACAGAAAAAGG - Intronic
1020637768 7:10716777-10716799 TGGGACCTTGGATCAGAAAAAGG + Intergenic
1020672611 7:11136591-11136613 TAGGATGTTAGAATAGAACATGG - Intronic
1021348567 7:19559092-19559114 TGGTATCTTGGAAGAGAAGAAGG - Intergenic
1021568972 7:22045124-22045146 TGGGATCTTGGAATAGAAAAAGG + Intergenic
1021812117 7:24412804-24412826 TGGGATCTTGGGTCAGAAAAAGG + Intergenic
1022636552 7:32141706-32141728 TGGGATCCTAGAACAAAAAAAGG + Intronic
1023135289 7:37045172-37045194 TGGAATCCTGGAATACAAAAAGG + Intronic
1023389588 7:39696462-39696484 TGGGATCCTGGAACAGAAAAAGG + Intronic
1023437522 7:40153884-40153906 TGGGATCCAAGAAGAGAAACTGG + Intronic
1023453225 7:40310434-40310456 TGGGATCTTGGAATAGAAAAAGG + Intronic
1023902789 7:44496678-44496700 TAGGATCCTGGAACAGAAAAAGG + Intergenic
1024018652 7:45344423-45344445 TGAGATCCAAGTATAGAAAAAGG + Intergenic
1024840841 7:53585416-53585438 GGGAATATTAGAAAAGAAAAAGG + Intergenic
1024901660 7:54324728-54324750 TGGGACCCTATAACAGAAAAAGG + Intergenic
1025604509 7:63029730-63029752 TTGGATCCTAGACCAGAAAAAGG - Intergenic
1026074961 7:67157655-67157677 TGGGATCCTGGAATATAAAAGGG - Intronic
1026080075 7:67210091-67210113 TGGGATCCTAGAACAGAAAAAGG - Intronic
1026697017 7:72603936-72603958 TGGGATCCTAGAACAGAAAAAGG + Intronic
1026701893 7:72654507-72654529 TGGGATCCTGGAATATAAAAGGG + Intronic
1026763131 7:73141576-73141598 TGGGATCTTCGGACAGAAAAAGG + Intergenic
1027039596 7:74951358-74951380 TGGGATCTTCGGACAGAAAAAGG + Intergenic
1027084046 7:75251026-75251048 TGGGATCTTCAGACAGAAAAAGG - Intergenic
1027393233 7:77726267-77726289 TGGGATCCTTGAACAGAAAAAGG - Intronic
1027612833 7:80383910-80383932 TGGGATCCTGAAACAGAAAAAGG - Intronic
1027857557 7:83532212-83532234 TGGGATTTGAGAACATAAAATGG + Intronic
1027961457 7:84951073-84951095 TGGGATCCTTAAATAGACAAAGG + Intergenic
1028721023 7:94031745-94031767 TGAGATGTTTGAATAGAAGAAGG + Intergenic
1028769050 7:94594540-94594562 TGGAATCCTAGAACAGAAAAAGG + Intronic
1029001147 7:97156108-97156130 TGGAATCCTGGAACAGAAAAAGG - Intronic
1029155822 7:98517259-98517281 TGGAAGCTTAGGATAGAAAATGG + Intergenic
1029240381 7:99157198-99157220 TGGCATCATGGAAAAGAAAAAGG - Intergenic
1029391620 7:100278792-100278814 TGGGATCTTCGGACAGAAAAAGG - Intergenic
1030151988 7:106416479-106416501 TGGGATCTTAGATCAAGAAAAGG - Intergenic
1030226170 7:107153716-107153738 TGGGATCTTAGAAAAGTATTAGG - Intronic
1030528519 7:110682541-110682563 TGGGAGCTGAGAAAAGAACAAGG + Intronic
1030824506 7:114138866-114138888 TGGTATCTTGGAACAGAAAAAGG + Intronic
1030920471 7:115378537-115378559 TGAGATTTTGGAACAGAAAAAGG - Intergenic
1031094100 7:117398761-117398783 TGAGATATTAGAGTAGAAAGTGG - Intronic
1032371442 7:131357161-131357183 TAGGAACTTGGAACAGAAAAAGG - Intronic
1032707882 7:134437788-134437810 TGGGATCTTGGGATGGAAAAAGG - Intergenic
1032931224 7:136674092-136674114 TTGGATCCTGGAACAGAAAAAGG - Intergenic
1033413378 7:141140598-141140620 TGGGATCCTGGTACAGAAAAAGG - Intronic
1033448654 7:141443335-141443357 CGGGATCCTAGAACAGAAAAGGG - Intronic
1033906110 7:146205134-146205156 TGTGTTCTTGGAATAGAGAAAGG - Intronic
1034113987 7:148566056-148566078 TGGGATCTTGGAACAGAGAAAGG + Intergenic
1034516850 7:151587794-151587816 TGGGATCCTCCAACAGAAAACGG + Intronic
1034736727 7:153435901-153435923 TGGAATCTTGGAACAGAAAAAGG - Intergenic
1035845001 8:2853399-2853421 TGGGATCCTGCAAGAGAAAAAGG + Intergenic
1036197851 8:6736296-6736318 TTGTATTTTAGAACAGAAAAAGG - Intronic
1036451074 8:8868099-8868121 TGGGAACTTGGTCTAGAAAATGG - Intronic
1036780462 8:11643432-11643454 TTGGATCCTAGACCAGAAAAAGG + Intergenic
1037489730 8:19386696-19386718 TTGGAATTTTGAATAGAAAAGGG + Intronic
1037535000 8:19816228-19816250 TGGGTTTGTAGAATAGAAGATGG - Intergenic
1037816017 8:22112245-22112267 TTGGATCCTGGAACAGAAAAAGG + Intergenic
1038557493 8:28535454-28535476 TGGGATCTTAGAACAGAAATAGG - Intronic
1038585803 8:28788313-28788335 TTGGATCCTGGAACAGAAAAGGG - Intronic
1039006302 8:33041410-33041432 TGGGATCCTGGAATAGAAAAAGG - Intergenic
1039305821 8:36261277-36261299 TGAGATCCTGGAATAGAAAAAGG + Intergenic
1039526595 8:38222022-38222044 TGGAATCTCAGAAGAGAAAAGGG - Intergenic
1039767483 8:40645051-40645073 TGGGATCCTGAAACAGAAAAAGG + Intronic
1039926649 8:41939790-41939812 TGGGATCCTGGAACAGAAAAAGG + Intronic
1040628616 8:49181579-49181601 TGGGATCCTGGCACAGAAAAAGG + Intergenic
1040998734 8:53428239-53428261 TGGGACCCTAGAACAGAAAAAGG + Intergenic
1041406715 8:57507652-57507674 TAGTATCATAGAATATAAAAAGG + Intergenic
1041559007 8:59193180-59193202 TGGGATGTTAGAACAGAAAAAGG - Intergenic
1041606690 8:59790062-59790084 TGGGATCCTAGAACAATAAAAGG + Intergenic
1041822893 8:62059839-62059861 TGAGATCCTGGAACAGAAAAAGG + Intergenic
1041828678 8:62127421-62127443 TGGGACCCTGGAACAGAAAAAGG + Intergenic
1042658189 8:71124853-71124875 TGGGATCTAAGAATGGTAAGAGG + Intergenic
1043026001 8:75069770-75069792 TTAGATCCTAGAACAGAAAATGG + Intergenic
1043338544 8:79207936-79207958 TGGGATCCTAGAACAGAGAAAGG - Intergenic
1043489809 8:80737905-80737927 TTGGATCTTGGAAGAGAAAAAGG - Intronic
1043709315 8:83395245-83395267 TTGAATCATAGACTAGAAAAAGG - Intergenic
1044069122 8:87734190-87734212 TGGGGTCCTAGAACAGAAAAAGG + Intergenic
1044109526 8:88254779-88254801 TGGGATCCTGGAACAGAAAAAGG + Intronic
1044472109 8:92582341-92582363 TGGGAGATTAGAATCCAAAAGGG - Intergenic
1044628714 8:94259062-94259084 TGGAATCTCAGAAGAGTAAAGGG - Intronic
1044902151 8:96958139-96958161 TGGGATTTTAGAAAAGAAGAAGG - Intronic
1045014949 8:97992998-97993020 TGGGATCTTACTATAGAGAGTGG + Intronic
1045174699 8:99709773-99709795 TGGGATCCTGAAACAGAAAAAGG + Intronic
1045416539 8:101973207-101973229 TGGGATCCTGGGATGGAAAAAGG - Intronic
1045453584 8:102353564-102353586 TGGGATCTTAGAACAGAAAAAGG + Intronic
1045478361 8:102572687-102572709 TGGGATCTTGAAACAGAAAAGGG + Intergenic
1045734968 8:105284288-105284310 TGGTATCTTAGAGAAGAGAAGGG + Intronic
1046028844 8:108758794-108758816 TGGGATGTTAGAAAAATAAATGG + Intronic
1046172262 8:110525971-110525993 TGGGATCCTAGAACAGAATCAGG + Intergenic
1046175059 8:110564734-110564756 TGGGTTTTAAGAATACAAAATGG - Intergenic
1047088022 8:121541437-121541459 TGGGATACTGGAGTAGAAAAAGG - Intergenic
1047329747 8:123876111-123876133 TGGGGTCAGAGAATAGACAAAGG - Intronic
1047549509 8:125854546-125854568 TGGGATTTGAGAATATAATAGGG + Intergenic
1047552373 8:125889003-125889025 TGGGATCCTGGAACAGAAGAAGG - Intergenic
1047599083 8:126408543-126408565 AGGGATCATAGGAAAGAAAAGGG + Intergenic
1047610232 8:126513658-126513680 TTGGTTCTTGGAACAGAAAAAGG - Intergenic
1048238773 8:132719876-132719898 TGGGATCCTGGAATAGAAAAAGG - Intronic
1048626351 8:136189811-136189833 TGGGATCATAGAATTGTTAAAGG + Intergenic
1049923174 9:384018-384040 TGGGATCCTGGGACAGAAAAAGG - Intronic
1050758417 9:9036462-9036484 TGGGATTCTGGAATAGCAAAAGG + Intronic
1050778015 9:9292663-9292685 TGGAATCCTGGAACAGAAAAAGG - Intronic
1051044832 9:12860158-12860180 TGGAATCATAGAAAAGAAAAGGG - Intergenic
1051244307 9:15093665-15093687 ATGGATTTTAGAACAGAAAAAGG - Intergenic
1051344278 9:16138591-16138613 AGGGGTCTCAGAAAAGAAAATGG - Intergenic
1051461771 9:17326923-17326945 TGGGATCCTGAAACAGAAAAAGG + Intronic
1051795181 9:20860244-20860266 TGGGATCCTGGAACAGAAAAAGG - Intronic
1052260327 9:26507993-26508015 TGAGTACTTAGAAAAGAAAATGG + Intergenic
1052338590 9:27343022-27343044 TGGTTTTGTAGAATAGAAAAGGG + Intronic
1052493829 9:29200741-29200763 TGGGATCCTGCAATAGAAAAAGG - Intergenic
1052806588 9:33019004-33019026 TGGGATCCTGGAACAGAAAAGGG + Intronic
1053364000 9:37510003-37510025 TGGGATCCTGGAATGGAAAAAGG + Intergenic
1053383434 9:37667764-37667786 TGGGATCCTAAAATTGCAAAGGG + Intronic
1053550405 9:39073530-39073552 TGGGGTTTTAGATGAGAAAATGG - Exonic
1054833246 9:69649227-69649249 TAGGATCTTTGATTGGAAAAGGG - Intronic
1054859773 9:69938005-69938027 TGGCATCTTAGAAGAGGAACTGG + Intergenic
1055362692 9:75511091-75511113 TAGGATCCTGGAACAGAAAAAGG - Intergenic
1056435485 9:86571822-86571844 TTGAATCTTGGAACAGAAAAAGG - Intergenic
1056733278 9:89183663-89183685 TGGGAGCTAAGAAAAAAAAACGG + Intergenic
1056925885 9:90834292-90834314 TGGGAACTTTGAATAGAAGAGGG - Intronic
1057024822 9:91726783-91726805 AGAGAACTTAGAGTAGAAAAGGG - Intronic
1057060072 9:91995933-91995955 TGGGAACCTGGAAGAGAAAAAGG - Intergenic
1057749832 9:97783208-97783230 TGACATCTTAGAACAGAATAGGG + Intergenic
1057811326 9:98259017-98259039 TGGGATCTTGGAATAGAAAAAGG - Intergenic
1057841853 9:98492568-98492590 TGGGATCCAGGAATAGAAAAAGG - Intronic
1058005363 9:99907843-99907865 GTGGATCCTAGAATAGAAAAAGG - Intronic
1058185570 9:101850335-101850357 TTGGAGCTGAAAATAGAAAATGG + Intergenic
1058223703 9:102334371-102334393 AGGGATCCTAGAATTGAAAAAGG + Intergenic
1058605351 9:106715674-106715696 AGGGATCCTAGGAAAGAAAATGG + Intergenic
1058807787 9:108608945-108608967 TGGGATCTTTGAATTCTAAATGG + Intergenic
1059470484 9:114501700-114501722 TGGTATCCTAGAATAAAATAAGG + Intronic
1059510218 9:114838259-114838281 TGAGATCTTGGAACAGAAAAAGG - Intergenic
1060165214 9:121407798-121407820 TGGGAGCCTGGAACAGAAAAAGG - Intergenic
1060277834 9:122195397-122195419 TGGGATCCTGCAACAGAAAATGG - Intronic
1060680320 9:125557011-125557033 TTGAATTTTAAAATAGAAAAAGG + Intronic
1060699871 9:125741295-125741317 TGGGATCCTGGAACAGAAAAGGG - Intergenic
1061072289 9:128318434-128318456 TGGAGTCCCAGAATAGAAAAAGG + Intronic
1061383108 9:130270900-130270922 TGGGATCCTGGAGCAGAAAAAGG - Intergenic
1061663271 9:132144999-132145021 TGAGATCCTGGAACAGAAAAAGG - Intergenic
1203635811 Un_KI270750v1:109667-109689 TTGGATCCTTGAATAGGAAAAGG + Intergenic
1186106541 X:6213412-6213434 TGGTACCTCAGAAGAGAAAAAGG + Intronic
1186156141 X:6728820-6728842 TGCGATCCTGGAATAAAAAAGGG - Intergenic
1186583264 X:10843968-10843990 TGAGATCTTGGAACAGAAAAAGG + Intergenic
1186895340 X:13999613-13999635 TGGGATCTTGGAGCAGAAAAAGG - Intergenic
1187013176 X:15300612-15300634 TGGGATCCTGGAACAGAAATAGG + Intronic
1187185855 X:16984592-16984614 TGGAATATTAGAATATGAAAAGG - Intronic
1187291107 X:17953987-17954009 TTGGATCCCAGAACAGAAAAAGG + Intergenic
1187482698 X:19672689-19672711 TGGGATCCTGCAACAGAAAAAGG + Intronic
1187535614 X:20139294-20139316 TGGGGTCATATAATAGAAACAGG - Intronic
1187686684 X:21822339-21822361 TGAGATATTAGTATAAAAAATGG - Intergenic
1188239435 X:27767245-27767267 TGGGATCCTGGAATACAGAAAGG + Intergenic
1188695586 X:33186266-33186288 TGAGATGTTAGAATAAGAAAAGG - Intronic
1189076127 X:37916893-37916915 TGGGATCCTGGAACAGAATAAGG - Intronic
1189162603 X:38825796-38825818 TGGGGTCTTAGGACAGGAAAAGG + Intergenic
1189530210 X:41872751-41872773 TGGGATCCTGGAGCAGAAAAAGG - Intronic
1189666467 X:43360230-43360252 TGGAATCTTGGAACAGAAAATGG + Intergenic
1189710457 X:43806228-43806250 TGGGATCCTGCAACAGAAAAAGG - Intronic
1189909977 X:45800944-45800966 TGGGATCCTGGAACAGAAAAAGG + Intergenic
1190036172 X:47026513-47026535 TGGGATCCTGGAACAGAAAAAGG - Intronic
1190138328 X:47817336-47817358 TGGGATGTTACAATAAAAAATGG + Intergenic
1190281403 X:48933247-48933269 TGGGATCCTGGAACAGATAAAGG + Intronic
1190714129 X:53089746-53089768 TGGAATCCTGGAACAGAAAAAGG - Intergenic
1190926085 X:54906247-54906269 TTGGATCCTGGAATACAAAAAGG - Intergenic
1191086567 X:56573956-56573978 TGGGATGCTAGAACAGGAAAAGG - Intergenic
1191624879 X:63259877-63259899 TTGTATGTTAGAACAGAAAAAGG + Intergenic
1191658078 X:63621245-63621267 TGGGATCCTAAAACAGAAAAAGG - Intergenic
1192302524 X:69920415-69920437 TGGAATCTTGGAACAGAAAGAGG - Intronic
1192337328 X:70232970-70232992 TGGGATCCTGGGACAGAAAATGG + Intergenic
1192339170 X:70248417-70248439 TGGGATCCTGGAACAGTAAAAGG - Intergenic
1192483558 X:71505690-71505712 TGGGATCCTGGAATAGAAAAAGG + Intronic
1192607911 X:72539024-72539046 TGGGATCTGGGGACAGAAAAAGG + Intronic
1192845095 X:74898485-74898507 TGGGATTTCAGAACAGAAAAAGG + Intronic
1192894809 X:75431024-75431046 TGGGATCCTGGAACAGATAAAGG + Intronic
1194246284 X:91515702-91515724 TGGGATTTTTGAAAAGAAAAAGG - Intergenic
1194829228 X:98600033-98600055 TGGGATCCTTGAACAGAAAAAGG + Intergenic
1195083647 X:101393823-101393845 TGGGGTCCTAGAACAGAAAAAGG + Intronic
1195169072 X:102248421-102248443 TAAGATCCTAGAATAGAAAAAGG - Intergenic
1195189785 X:102438668-102438690 TAAGATCCTAGAATAGAAAAAGG + Exonic
1195306577 X:103588831-103588853 TGGGATCCTGGAACAGAAAAAGG - Intergenic
1195604835 X:106793572-106793594 TGGGATCCTGGGACAGAAAAAGG - Intronic
1196815091 X:119658948-119658970 TGGTATCTTTCAATACAAAAGGG + Intronic
1196921080 X:120585789-120585811 TGAGATCCTAGAACAGAAAAAGG - Intergenic
1197242391 X:124133854-124133876 TTGGATCCTGCAATAGAAAAAGG + Intronic
1197325467 X:125088344-125088366 TGGGATCCTGCAACAGAAAATGG + Intergenic
1197547702 X:127846611-127846633 AGGGTTCTAAGAATACAAAAGGG - Intergenic
1197716475 X:129711008-129711030 TGGGATCCTGGAATAGAAAAAGG + Intergenic
1198200961 X:134418237-134418259 TGGTAGCTTAGAATAGGATATGG + Intronic
1198374022 X:136019810-136019832 TGGGACCCTGGAATAGAAAAAGG - Intronic
1198492828 X:137159920-137159942 TGGGATCCTAAAACAAAAAAAGG + Intergenic
1198603968 X:138315968-138315990 TTGGCTCTTGGAACAGAAAAAGG - Intergenic
1198806050 X:140495819-140495841 TAGGATCCTGGAAAAGAAAAAGG - Intergenic
1198986360 X:142458777-142458799 TAGAATCTCAGAATAGAAAGTGG - Intergenic
1199367238 X:147001528-147001550 TTGCATGTTAGAACAGAAAAGGG - Intergenic
1199732613 X:150651423-150651445 TGGGATCCTTAAACAGAAAAAGG - Intronic
1200528921 Y:4309714-4309736 TGGGAGCTAAGAATACAAAGTGG + Intergenic
1200565250 Y:4756951-4756973 TGGGATTTTTGAAAAGAAAAAGG - Intergenic
1201549611 Y:15206305-15206327 TGCGATCCTGGAATACAAAAGGG - Intergenic
1201667915 Y:16479786-16479808 TGGGATTTTGGAACATAAAAGGG + Intergenic