ID: 923997438

View in Genome Browser
Species Human (GRCh38)
Location 1:239511087-239511109
Sequence ATGAGGCTGCTCAGCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923997438_923997442 22 Left 923997438 1:239511087-239511109 CCTTCACTGCTGAGCAGCCTCAT No data
Right 923997442 1:239511132-239511154 GTACGTTAAGTCAAGGAATTGGG 0: 1
1: 0
2: 1
3: 5
4: 60
923997438_923997441 21 Left 923997438 1:239511087-239511109 CCTTCACTGCTGAGCAGCCTCAT No data
Right 923997441 1:239511131-239511153 TGTACGTTAAGTCAAGGAATTGG 0: 1
1: 0
2: 0
3: 3
4: 68
923997438_923997443 23 Left 923997438 1:239511087-239511109 CCTTCACTGCTGAGCAGCCTCAT No data
Right 923997443 1:239511133-239511155 TACGTTAAGTCAAGGAATTGGGG 0: 1
1: 0
2: 0
3: 6
4: 79
923997438_923997440 15 Left 923997438 1:239511087-239511109 CCTTCACTGCTGAGCAGCCTCAT No data
Right 923997440 1:239511125-239511147 GATTCATGTACGTTAAGTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923997438 Original CRISPR ATGAGGCTGCTCAGCAGTGA AGG (reversed) Intronic
No off target data available for this crispr