ID: 923998930

View in Genome Browser
Species Human (GRCh38)
Location 1:239529038-239529060
Sequence TGGATTATGAAGGAAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923998930_923998935 4 Left 923998930 1:239529038-239529060 CCTCCCATTTCCTTCATAATCCA 0: 1
1: 0
2: 1
3: 26
4: 258
Right 923998935 1:239529065-239529087 TGTTTTTATTTAGTACTTAATGG 0: 1
1: 0
2: 4
3: 68
4: 626
923998930_923998936 9 Left 923998930 1:239529038-239529060 CCTCCCATTTCCTTCATAATCCA 0: 1
1: 0
2: 1
3: 26
4: 258
Right 923998936 1:239529070-239529092 TTATTTAGTACTTAATGGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 192
923998930_923998937 20 Left 923998930 1:239529038-239529060 CCTCCCATTTCCTTCATAATCCA 0: 1
1: 0
2: 1
3: 26
4: 258
Right 923998937 1:239529081-239529103 TTAATGGAGTGGTTCTGAAATGG 0: 1
1: 0
2: 3
3: 19
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923998930 Original CRISPR TGGATTATGAAGGAAATGGG AGG (reversed) Intronic
905012901 1:34759235-34759257 TGGATTGTGTAGGAAATGGGAGG - Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905612895 1:39370532-39370554 GGGATTTTGCAGGGAATGGGAGG - Intronic
906143500 1:43546991-43547013 TGGATTAGGAAGGAAAAGACTGG - Intronic
906333645 1:44909126-44909148 TGGATGAAGAAGGAAATGAGGGG + Intronic
906637823 1:47421404-47421426 TGGAGTATTATGGAAATGAGGGG + Intergenic
908429641 1:64043310-64043332 TGGTTGATGAAGTAAATGGAAGG - Intronic
908741163 1:67329113-67329135 CGGTCTATGAAAGAAATGGGAGG - Intronic
909672063 1:78200468-78200490 TGGTTTAGGAAGGGGATGGGGGG - Intergenic
910104305 1:83614580-83614602 TGGTTTAAGAAGTAAGTGGGAGG + Intergenic
911839932 1:102669035-102669057 TGAATTATGAATAAAATGGTGGG - Intergenic
912888775 1:113505118-113505140 AGGAGTAGGAAGGAAAAGGGAGG + Intronic
913153773 1:116073723-116073745 TATATTATCAAGGAAATGGGGGG - Intergenic
913705138 1:121413498-121413520 GGGATAGAGAAGGAAATGGGTGG + Intergenic
914890884 1:151622331-151622353 TTGAATATATAGGAAATGGGTGG + Intronic
915298794 1:154940446-154940468 TGGCTACTGTAGGAAATGGGAGG - Intergenic
916992946 1:170264716-170264738 TGGCTAATGAAGTAAATGAGGGG - Intergenic
920609158 1:207420915-207420937 TGAAGTATGAGGGAAGTGGGTGG + Intergenic
920760981 1:208783497-208783519 TGGATAGTGAAGGCAGTGGGGGG - Intergenic
921309131 1:213825385-213825407 TGGAATATAAAGGAAGAGGGAGG + Intergenic
921470542 1:215543159-215543181 TGGGTTATGGGGGAAAAGGGAGG - Intergenic
922403604 1:225287403-225287425 TGAATAATGAAGTAAATGGATGG + Intronic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
924416389 1:243860742-243860764 ATGATTCTGAAGGATATGGGAGG + Intergenic
924800490 1:247326563-247326585 TGGGTTATGCAGGAAGTGGGGGG - Intronic
1064504277 10:16012370-16012392 TGGATTCTGAATGAAAGGGCTGG + Intergenic
1065778929 10:29148634-29148656 TGGATTACTAAAGAAAAGGGTGG - Intergenic
1066224755 10:33371301-33371323 AGTATGATGAAGGAAATAGGTGG - Intergenic
1066504892 10:36031245-36031267 TAGACTGTGAAGGAGATGGGCGG + Intergenic
1068561457 10:58519220-58519242 TGGTTTATGCAGGAAAAAGGCGG + Intronic
1068846690 10:61684513-61684535 TTGATTTGGAAGGGAATGGGTGG - Intronic
1069361798 10:67651460-67651482 TGGATAAACAGGGAAATGGGAGG - Intronic
1071150635 10:82630195-82630217 CGGAATAAGAAGAAAATGGGAGG + Intronic
1071969261 10:90886540-90886562 TACCTTATGATGGAAATGGGAGG - Intronic
1074814390 10:117133773-117133795 TGGATTCAGAAGGAAGTTGGGGG + Exonic
1075406027 10:122196198-122196220 TGGTTTTAGAAAGAAATGGGTGG + Intronic
1078155262 11:8794564-8794586 TGGACTATGAAGGAAAATGAAGG + Intronic
1078288067 11:9978178-9978200 TAGGTTATGCAGGAAATTGGGGG - Intronic
1079694884 11:23469169-23469191 TAAATTTTGAAGCAAATGGGAGG + Intergenic
1081565607 11:44259104-44259126 TGGACTCTGAAGGATTTGGGGGG + Intergenic
1082735939 11:56855660-56855682 GGAATAATGAAGGAAATGAGCGG - Intergenic
1082923208 11:58518320-58518342 TGGATTGTGGAGAGAATGGGAGG - Intergenic
1083089479 11:60185373-60185395 AGGAATAGGAAGGAAAGGGGTGG - Intergenic
1083190705 11:61050065-61050087 TGGAAGGGGAAGGAAATGGGAGG - Intergenic
1088122269 11:106384427-106384449 TGGGTTAAAAAGGGAATGGGAGG - Intergenic
1088355158 11:108935202-108935224 TGGCTTTTGAAGGATAAGGGAGG + Intronic
1090598284 11:128342824-128342846 TGCATTATCATAGAAATGGGAGG + Intergenic
1090994990 11:131857982-131858004 AGGGGTATGAAGGAAATTGGGGG - Intronic
1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG + Intronic
1091239936 11:134045662-134045684 TAGATTATGTAGGACTTGGGGGG - Intergenic
1091848428 12:3676124-3676146 TGAGTTAATAAGGAAATGGGTGG - Intronic
1092624157 12:10307663-10307685 TGGAAAATGAAGGAAATGATGGG - Intergenic
1093388620 12:18589646-18589668 AGGATTATTAAGAAAATGAGAGG + Intronic
1093608775 12:21128513-21128535 TGGATTATGAGTGTAAAGGGTGG + Intronic
1093684552 12:22041409-22041431 TGGATTAAGGAGGGAATGAGAGG + Intergenic
1094480478 12:30877325-30877347 GGGTTTATGAATGAAATGTGAGG + Intergenic
1095524356 12:43107653-43107675 TGGACTTTGAAGGAAAAGAGGGG - Intergenic
1095697700 12:45159262-45159284 GGGATGATGGGGGAAATGGGAGG + Intergenic
1095736262 12:45559581-45559603 TGCATTATGAAGGAACTGGAGGG + Intergenic
1097696870 12:62783300-62783322 TGGATTATGGAGGGAGTGGAAGG - Intronic
1097908620 12:64946127-64946149 TGGATAATGAAGGGAAAGGAAGG - Intergenic
1100288687 12:93192535-93192557 TGGATTAAGAAGAAAAGTGGTGG + Intergenic
1100576121 12:95892999-95893021 TGAATTCGGAAGGTAATGGGAGG - Intronic
1100651346 12:96592466-96592488 TGCAATATGAAGTAAATGGCAGG - Intronic
1101525233 12:105522619-105522641 TGGAGTAAGAAAGGAATGGGTGG + Intergenic
1106769932 13:32952185-32952207 TGTACCATGAAGGAAATGTGTGG + Intergenic
1106927589 13:34629871-34629893 TGGATTTTGAGGGAAAAGAGAGG - Intergenic
1107163733 13:37262050-37262072 TGGAATATGAAGGTACTGGAAGG - Intergenic
1108857669 13:54815000-54815022 TGCATTATAAGGGAAAGGGGTGG - Intergenic
1113646026 13:111996551-111996573 GAGATTTGGAAGGAAATGGGAGG - Intergenic
1115654865 14:35433696-35433718 TGGAACATGAAGGAAATAGTAGG + Intergenic
1116874705 14:50099426-50099448 TGGATTCTGGAGGCAATGAGAGG - Intergenic
1118329040 14:64801562-64801584 TGGCATATGAGGGAAGTGGGCGG + Intronic
1120067032 14:80054623-80054645 GAGATTATTAAGGAAATTGGAGG - Intergenic
1120412031 14:84169992-84170014 TGAATTCTGAAGAAAATGAGAGG + Intergenic
1125361316 15:38867434-38867456 TGGATTCTGAAGGAAATAGCTGG + Intergenic
1125714199 15:41810034-41810056 TGAATAAGGAAGGAAGTGGGAGG - Intronic
1126313907 15:47347698-47347720 GGCATTATGAAGGAAATGACAGG - Intronic
1127602260 15:60549745-60549767 TTGATTGGGAAGGAGATGGGAGG - Intronic
1128575586 15:68772298-68772320 TGGCTTTTGAAGGAAATGTGAGG - Intergenic
1128610351 15:69067948-69067970 TGGATTTTGAAGGAAAGGGCAGG - Intergenic
1130353153 15:83108490-83108512 TTCAATGTGAAGGAAATGGGTGG + Intronic
1130407339 15:83613587-83613609 TGGCTTATAGAGTAAATGGGAGG + Intronic
1130635776 15:85618532-85618554 TGGATCATGAATGATTTGGGAGG - Intronic
1130660967 15:85831196-85831218 GGGATTGGGAAGGGAATGGGAGG - Intergenic
1130757193 15:86777387-86777409 TGTAATAAGAAGGAAAGGGGAGG - Intronic
1132231228 15:100185766-100185788 GGGATGATGAAGGAAACGGCTGG - Intronic
1134792020 16:16997625-16997647 TGCAGCATAAAGGAAATGGGTGG - Intergenic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1136987444 16:35122420-35122442 TGTATTAAGAAGGAAATGGAGGG + Intergenic
1138640725 16:58384172-58384194 TGGAATATGAAGGTAAGGGAGGG - Intronic
1142574182 17:895316-895338 TGAACTATGAAGGGAAGGGGTGG - Intronic
1142619166 17:1154159-1154181 AGGATCATGAAGGACCTGGGAGG - Intronic
1143176867 17:4960420-4960442 TGGGGGAGGAAGGAAATGGGTGG - Intronic
1143944762 17:10581094-10581116 TGGAATAGGAAGGAAAAGGCTGG + Intergenic
1144524957 17:15981452-15981474 TGTAATAAGAAGGAAGTGGGGGG + Intronic
1144845698 17:18217780-18217802 AGGATTAGTAAGGAAGTGGGAGG - Intergenic
1145287722 17:21518951-21518973 TGGATTATTCATGACATGGGGGG - Intergenic
1145923222 17:28626964-28626986 TGGCATATGAAGGAGAAGGGCGG + Intronic
1145981093 17:29012102-29012124 TGGGTGATGAATGAATTGGGAGG - Intronic
1146004249 17:29150825-29150847 GGGATTTTGAAGAAAATGGGCGG - Intronic
1146004662 17:29153805-29153827 GGGATTTTGAAGAAAATGGGCGG + Intronic
1146230226 17:31101114-31101136 AGAGTTATAAAGGAAATGGGTGG - Intronic
1147184405 17:38705627-38705649 GGGAGTATGAAGGAGATGGTAGG + Exonic
1147806297 17:43134247-43134269 TGGATCATGAAGGAGGGGGGCGG - Intergenic
1147849650 17:43432020-43432042 TGAAGTATGCAGGAAAAGGGGGG - Intergenic
1149786694 17:59441488-59441510 TGGAAAATGAAGCAAATGTGTGG + Intergenic
1150398592 17:64839336-64839358 TGGATCATGAAGGAGGGGGGCGG + Intergenic
1151386746 17:73759693-73759715 TGCAGTAGGATGGAAATGGGAGG - Intergenic
1151979539 17:77500304-77500326 AAGATTTTGAAGGAAATGAGTGG + Exonic
1154136332 18:11782627-11782649 TGTCTTATTAAGGAGATGGGAGG + Intronic
1155362829 18:25018922-25018944 TGGAGTATGAAGGAAAAAGAGGG - Intergenic
1155999797 18:32371972-32371994 TGAGTTATGAAGTAAATGAGAGG + Intronic
1157160779 18:45312543-45312565 GGGGTAATGAAGCAAATGGGGGG + Intronic
1157278335 18:46328362-46328384 TGGTTTTTGAAGAAAATGGTTGG + Intronic
1158156920 18:54436488-54436510 TGGATATTGGAGGAAGTGGGAGG + Intergenic
1160971246 19:1768722-1768744 AGGATAATGAAGGAAATCAGGGG + Intronic
1162583453 19:11544837-11544859 TTCATTCTGAAGGCAATGGGAGG + Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1164286698 19:23823245-23823267 TGTATTGGGGAGGAAATGGGAGG - Intronic
1166225000 19:41389563-41389585 TTAATTAGGAAGGAAATGTGGGG - Intronic
1166694913 19:44846827-44846849 TGGATTAAGAAGGATGGGGGTGG - Intronic
1167005949 19:46776843-46776865 GGAATTCTGGAGGAAATGGGGGG - Intronic
1167134347 19:47608409-47608431 TCGAGGATGAAGGAAATGGAGGG - Intronic
925508583 2:4598372-4598394 TGGATAACAAAGGAAAGGGGTGG + Intergenic
925639061 2:5969988-5970010 TGGATTAGGAAGGAGAGAGGTGG - Intergenic
925689053 2:6502350-6502372 TGAATTATGATAGAAATGGATGG + Intergenic
925716217 2:6786485-6786507 TAGATTATGAAGGGAGTGAGGGG - Intergenic
926264585 2:11303723-11303745 TGAATTGTAAAGGGAATGGGAGG - Intronic
927225705 2:20764432-20764454 AGGACTATGAAGGAAATTGGAGG - Intronic
928640179 2:33289906-33289928 TGGGTTATGAAGGAAGCAGGTGG - Intronic
928745055 2:34402919-34402941 TGGAATATGAAGGAGAAGTGAGG - Intergenic
928777434 2:34782429-34782451 TGGAATAGGAAGGCAGTGGGAGG + Intergenic
929357326 2:41041441-41041463 TGGCTTTTGAAGGAAGTGTGAGG + Intergenic
929982489 2:46694729-46694751 TGGTTTGAGAAGGAAATGGTAGG + Intergenic
930686780 2:54317930-54317952 TAGATTATTAAGAAATTGGGAGG + Intergenic
931848405 2:66228595-66228617 TGGATTATGGAAGATTTGGGGGG + Intergenic
931982803 2:67712326-67712348 TGGGTTATGAACGATGTGGGGGG + Intergenic
932194549 2:69772036-69772058 AGGGTTATGAAGAACATGGGTGG - Intronic
932424527 2:71620669-71620691 GGGGTTAGGAGGGAAATGGGAGG + Intronic
933429512 2:82157675-82157697 TGAGTTATGGAGGAAAAGGGAGG - Intergenic
933632147 2:84671106-84671128 TGGAGTATGCAGGGAATGGGAGG + Intronic
934104392 2:88682411-88682433 TGGCTTAAGAATGAACTGGGAGG + Intergenic
935319940 2:101876729-101876751 TGGATTATTAAGGAAATTGATGG + Intronic
935361768 2:102251374-102251396 TGGAAGACAAAGGAAATGGGGGG + Intergenic
937951191 2:127388912-127388934 TGGAATATGCATGAAAGGGGTGG - Intergenic
938225347 2:129611238-129611260 TGGACAATAAAGGAAAAGGGAGG + Intergenic
938742906 2:134249397-134249419 TGGAGAATGGAGGAAATGAGAGG - Intronic
942653365 2:178191719-178191741 TGGAAGCTGGAGGAAATGGGAGG + Intergenic
944313964 2:198265683-198265705 TGGCCTATGAAGGAAATAGATGG - Intronic
945119393 2:206443052-206443074 GGGATTAAGAAGGAGATGCGTGG + Intergenic
945220576 2:207479364-207479386 TGCATAATGATTGAAATGGGAGG + Intergenic
945621248 2:212141573-212141595 TGGAGGCTGAAGGAAATTGGAGG - Intronic
946086724 2:217181117-217181139 TGCATCATGAAGTAAATGGAGGG + Intergenic
946137575 2:217660488-217660510 TGGATTCTGAAGGATTTGGAAGG - Intronic
946453487 2:219801068-219801090 TGGATTCTGAAGAGGATGGGTGG + Intergenic
946569944 2:221013571-221013593 TGGAGTTTGTAGGAAATGGAGGG - Intergenic
947718786 2:232355220-232355242 TGAATTAAGAAGCAGATGGGGGG + Intergenic
947948967 2:234131277-234131299 TAGATTGTGAGGGAAGTGGGAGG + Intergenic
1168994105 20:2119812-2119834 AGGATAATGAAGGGAAAGGGAGG - Intronic
1169518283 20:6342259-6342281 TGTTTTATGAAAGCAATGGGAGG - Intergenic
1170732223 20:18985250-18985272 TGGGAGGTGAAGGAAATGGGGGG + Intergenic
1171075940 20:22123362-22123384 TGGATCAGGAAGAAAATGGGAGG - Intergenic
1172680828 20:36713425-36713447 TGAATTATGAAAAAAAAGGGGGG + Intronic
1172961583 20:38804397-38804419 TGGATTATTAATGAACTGAGAGG + Intergenic
1173225596 20:41160712-41160734 TGGATCATGATGGTAATGGTAGG + Intronic
1173556215 20:43967685-43967707 TGGTTTATTAATGAGATGGGTGG - Intronic
1174511462 20:51056607-51056629 TTGATGGAGAAGGAAATGGGTGG + Intergenic
1178536033 21:33411216-33411238 CGGAAAATGAAGGAAATGGAAGG + Intronic
1181885573 22:26019537-26019559 TGCATTATGCAGGGAATGGGAGG - Intronic
1182902291 22:33908524-33908546 TTGATGATGCATGAAATGGGGGG + Intronic
1184901551 22:47449456-47449478 TGGATTAGGGAGGAAATGTAAGG + Intergenic
949699198 3:6736418-6736440 TTGATTCTGAACAAAATGGGAGG + Intergenic
952183206 3:30941461-30941483 TGGGTTATTAAGGTAGTGGGTGG + Intergenic
954992239 3:54851518-54851540 TGGGTTCTTCAGGAAATGGGAGG + Intronic
955004984 3:54960098-54960120 GTGATTATGAAAGAAATGTGTGG + Intronic
956486403 3:69726894-69726916 TGTATTATGAAAAAAATGCGTGG - Intergenic
959310971 3:104736540-104736562 TGGATTATGCATGGAAGGGGTGG - Intergenic
960012410 3:112848442-112848464 TGGAATATGAAGGCAATGTTAGG + Intergenic
960312717 3:116136133-116136155 AGGTATATGAAAGAAATGGGTGG - Intronic
960735685 3:120777309-120777331 AGGAGTATGTAGAAAATGGGAGG + Intronic
961372914 3:126442321-126442343 TGGAATAGGAAGGAAGCGGGCGG + Intronic
963956505 3:151260296-151260318 TAGATTAAGAAGGAAATGAGAGG - Intronic
965535878 3:169823223-169823245 TGGTATATGAAGGAAGTGAGGGG + Intronic
967060871 3:185871509-185871531 TGGATTATCATTGTAATGGGAGG + Intergenic
967489217 3:190069888-190069910 TGGATTGTGGAGAAAATTGGGGG + Intronic
967642620 3:191884368-191884390 TGGAATATGAAGTTAATGTGAGG - Intergenic
968002302 3:195214416-195214438 TGGTTTAGGATGGACATGGGTGG - Intronic
969574563 4:8029521-8029543 GGAAATATGATGGAAATGGGTGG - Intronic
970203879 4:13636316-13636338 TGCATTATTATGGTAATGGGTGG + Intergenic
970253701 4:14144870-14144892 TGACTTATGAAGGGAATTGGGGG + Intergenic
970400788 4:15715768-15715790 TGGGTTATGCATGAAATTGGGGG + Exonic
970598063 4:17617938-17617960 TGTATTAAGAAGAAAATGTGTGG - Intronic
971172879 4:24251479-24251501 TGGTTTAGGCAGGAAAAGGGAGG - Intergenic
972053185 4:34765774-34765796 TTAATTATAAAGGAAATGGAAGG - Intergenic
975571252 4:75820485-75820507 TGGATTAAAAAGGAAATTGATGG + Intergenic
977337741 4:95719608-95719630 TGGCTTATGAAGCAAATTGCTGG - Intergenic
980480675 4:133383542-133383564 GGGATTATGAAGGAGATGTTGGG + Intergenic
980603428 4:135057664-135057686 AGAATTATGAATGAAATTGGAGG + Intergenic
981627949 4:146781859-146781881 TGGAGTATGAAAGAAATCAGTGG + Intronic
981766819 4:148260564-148260586 TGGATTATTTTGGAAAGGGGAGG - Intronic
982120183 4:152135878-152135900 TGTATTATGAGGGAAATCAGTGG - Intergenic
982402443 4:154983118-154983140 GGGAAAATGAAGGAAAGGGGAGG + Intergenic
983498930 4:168477893-168477915 TGTCTTAAGAAGGAACTGGGTGG + Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
984744797 4:183204025-183204047 TGGTTTATGAAGGAAATCCCAGG + Intronic
986571917 5:9174547-9174569 TGCATTCTGAAGGACATGGAAGG - Intronic
987500274 5:18699989-18700011 TGGGTTATTAAGGAAAAAGGAGG + Intergenic
992030613 5:72717698-72717720 AGGATTAGTAAGGAAATGGAAGG + Intergenic
992096780 5:73370136-73370158 AGGTTTATGAGGGAAAAGGGAGG + Intergenic
992255335 5:74915328-74915350 TGGAGTTTGAAAGAAATGGAGGG + Intergenic
992623457 5:78616072-78616094 TGGATTGCCAAGGGAATGGGAGG - Intronic
995087455 5:108130219-108130241 TGGATTAGGAAAGAAATGACAGG + Intronic
995286186 5:110390934-110390956 TGTATTATAATGGAACTGGGAGG - Intronic
997185681 5:131879663-131879685 TGGATTTGGAAGTAAATAGGAGG - Intronic
997575465 5:134972858-134972880 TGGATTTTAAAGGAAAGAGGGGG + Intronic
998624108 5:143825970-143825992 AGGATTGTGAAGGAGCTGGGAGG - Intergenic
998843913 5:146286319-146286341 TGGATTATGATGTAAATGACAGG + Exonic
1000255831 5:159537374-159537396 TGGATGATGGAGGGAATGGGTGG + Intergenic
1000313288 5:160065028-160065050 TGGATTTTGAACGAAATTGATGG - Exonic
1003276443 6:4657947-4657969 AATATTATGAATGAAATGGGGGG + Intergenic
1008004107 6:46391774-46391796 AGGATTATGAAGGTGAAGGGGGG + Intronic
1009681625 6:66900775-66900797 TGGATTATTCATGAAAGGGGTGG + Intergenic
1011068216 6:83352723-83352745 AAGATTTTGTAGGAAATGGGAGG - Intronic
1012817978 6:104048594-104048616 TTGATTATGAAGGAGTTGGAGGG - Intergenic
1014610943 6:123545227-123545249 TGGTTTAAGAAGGAATTTGGGGG - Intronic
1014616018 6:123600487-123600509 TGGACAATGGAGAAAATGGGTGG + Intronic
1015196036 6:130525570-130525592 TGGAGTAGGAAGGAAAGAGGGGG + Intergenic
1015265205 6:131284730-131284752 AGGTTTATGAAGAAAATGGAAGG + Intergenic
1015862206 6:137692727-137692749 AGGATGATGAAGGATATGGTAGG - Intergenic
1016615562 6:146044069-146044091 TGCACTAAGAAGGAAATGGCAGG - Intronic
1018772718 6:166986184-166986206 TAGATAGTGAAGGAACTGGGTGG - Intergenic
1018778668 6:167043184-167043206 TGGTTCATGAAGGACATGGGAGG + Exonic
1018792826 6:167162527-167162549 TAGATTTTGAAGGAAAGGGGAGG + Intronic
1020053926 7:5103755-5103777 AGGATTTTGTAGGAAATGGGAGG - Intergenic
1020801503 7:12738316-12738338 TGGATTAGGAGGAAAATGGTGGG - Intergenic
1021417683 7:20407043-20407065 TGGATTATGAAGGAAAATTATGG + Intronic
1021860217 7:24898549-24898571 TGGATTGTGAAGGCCATGGATGG - Intronic
1022747804 7:33190388-33190410 TGGCCTCTGCAGGAAATGGGAGG - Intronic
1024932797 7:54681264-54681286 TGGATTTTGGAGGGAATGGGAGG - Intergenic
1024959052 7:54956312-54956334 TCGATTATGGAGGAAATATGTGG + Intergenic
1026548042 7:71341439-71341461 TGAATTATGTAGGAACTGGGTGG - Intronic
1028252248 7:88550620-88550642 TGGATTATGATGGAAAGATGAGG + Intergenic
1028841811 7:95436623-95436645 AGGAATATGAAGATAATGGGTGG - Intergenic
1029176152 7:98665979-98666001 GGGAAAATGAAGGAACTGGGGGG - Intergenic
1031181482 7:118422909-118422931 TGCATTATGTAGAAAATGGAAGG + Intergenic
1031730589 7:125295350-125295372 TGGATTTGGAAGGAAATAGCAGG - Intergenic
1032828230 7:135593811-135593833 TGAATTAAAATGGAAATGGGAGG + Intronic
1033515430 7:142100834-142100856 TGGATGATGAAGGAACTGCTGGG + Exonic
1033781233 7:144671722-144671744 GGGAATATGCAGGAATTGGGAGG - Intronic
1034222140 7:149455087-149455109 TGTAATATGAAAGAAAGGGGTGG - Intronic
1034706096 7:153146422-153146444 TGGTTTATGGAGGAAAGGGAAGG - Intergenic
1035663222 8:1362704-1362726 TGAATTAAAAAGCAAATGGGCGG - Intergenic
1037046787 8:14315443-14315465 AAGATTATGAAGCAAATGGAAGG + Intronic
1037358271 8:18046125-18046147 TGGATAAAGAAGGAAATAAGTGG - Intergenic
1037564070 8:20102420-20102442 TGGATTATTCAGTAAATGGTTGG - Intergenic
1038127069 8:24686256-24686278 TGTAGAAAGAAGGAAATGGGAGG - Intergenic
1038434211 8:27523317-27523339 ATGATTATGAATGAAATGGTGGG - Intronic
1039635427 8:39159550-39159572 AGGCTGAGGAAGGAAATGGGTGG - Intronic
1040031963 8:42832865-42832887 TGGTTTAGGAAGGGGATGGGGGG + Intergenic
1040398937 8:47028379-47028401 TGGATTAAGCAGTAAGTGGGAGG + Intergenic
1041198305 8:55424004-55424026 TGGATTATGTAGGGACTGTGGGG - Intronic
1044670086 8:94670991-94671013 TGGAGTATGAAGGTAATGAGGGG + Intronic
1045358754 8:101412946-101412968 TGGATTAAGAAGGAAGAGGGAGG - Intergenic
1045496236 8:102711706-102711728 AAAATTATGATGGAAATGGGAGG - Intergenic
1048148387 8:131868170-131868192 TTGATTATGAATGAGATTGGAGG - Intergenic
1048961369 8:139582174-139582196 AGGATTAACAAGGAAATTGGAGG - Intergenic
1051059310 9:13027737-13027759 TGGATTATCAAGTACATGTGAGG - Intergenic
1055605851 9:77969708-77969730 TGGATTTTCCAGGAAATTGGGGG + Intronic
1055748741 9:79480221-79480243 TATAGGATGAAGGAAATGGGTGG + Intergenic
1058018217 9:100061020-100061042 TGAAGTATTCAGGAAATGGGTGG - Intronic
1059359941 9:113734344-113734366 TCCATGAGGAAGGAAATGGGAGG + Intergenic
1059691281 9:116687756-116687778 AGAAATATGAAGGAACTGGGGGG + Intronic
1060289570 9:122288670-122288692 TGGGATATGAAGAAAATGGAAGG + Intronic
1061359854 9:130134206-130134228 TGGTCTATGAGGGAACTGGGTGG - Intronic
1061700013 9:132408909-132408931 TAGATTTTGAAGGGAAGGGGAGG - Intergenic
1186109934 X:6245039-6245061 GGGATTTTGGGGGAAATGGGTGG - Intergenic
1188692278 X:33144839-33144861 TCTATGATGAAGGAAATGGTGGG - Intronic
1189612805 X:42754807-42754829 TGTAGTGTGAAGGAAATTGGAGG - Intergenic
1189828759 X:44948582-44948604 TGTACTGTGAAGGAAATGGTGGG + Intronic
1189980204 X:46502475-46502497 TAGACTATGAAGGAAATAGCAGG + Intronic
1191060436 X:56290029-56290051 TGGATACAGAAGGAACTGGGTGG + Intergenic
1193758940 X:85441428-85441450 TGGAGAATGAAGAAAAGGGGGGG - Intergenic
1195938112 X:110144465-110144487 TGGAATATGAAGGACCTGAGTGG - Intronic
1198267164 X:135020799-135020821 TTGATTATGTAGGTAGTGGGGGG - Exonic
1201104201 Y:10751372-10751394 TGAATTGTGAATGAAATGTGAGG - Intergenic