ID: 924004029

View in Genome Browser
Species Human (GRCh38)
Location 1:239587172-239587194
Sequence CAGCACGTGGAGGTGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924004029_924004033 -8 Left 924004029 1:239587172-239587194 CCTGGCCTCACCTCCACGTGCTG 0: 1
1: 0
2: 6
3: 38
4: 317
Right 924004033 1:239587187-239587209 ACGTGCTGTACAGAGCAGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 141
924004029_924004035 2 Left 924004029 1:239587172-239587194 CCTGGCCTCACCTCCACGTGCTG 0: 1
1: 0
2: 6
3: 38
4: 317
Right 924004035 1:239587197-239587219 CAGAGCAGTGAGGTAGGTTCTGG 0: 1
1: 0
2: 2
3: 22
4: 192
924004029_924004036 5 Left 924004029 1:239587172-239587194 CCTGGCCTCACCTCCACGTGCTG 0: 1
1: 0
2: 6
3: 38
4: 317
Right 924004036 1:239587200-239587222 AGCAGTGAGGTAGGTTCTGGTGG 0: 1
1: 0
2: 2
3: 42
4: 600
924004029_924004034 -4 Left 924004029 1:239587172-239587194 CCTGGCCTCACCTCCACGTGCTG 0: 1
1: 0
2: 6
3: 38
4: 317
Right 924004034 1:239587191-239587213 GCTGTACAGAGCAGTGAGGTAGG 0: 1
1: 0
2: 0
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924004029 Original CRISPR CAGCACGTGGAGGTGAGGCC AGG (reversed) Intronic
900097328 1:945261-945283 CAGCAGGTGGAGAGGAGCCCTGG + Intronic
901013443 1:6213741-6213763 CAGGACATGGAGGAGAGGGCAGG + Intronic
901462223 1:9398544-9398566 GAGCAGAGGGAGGTGAGGCCAGG - Intergenic
901491153 1:9597042-9597064 CCCCGCGAGGAGGTGAGGCCGGG + Exonic
901763809 1:11487622-11487644 CAGCTGGAGGAGGTGAAGCCTGG - Intronic
902650539 1:17834469-17834491 CAGCACTTAAAGGAGAGGCCTGG - Intergenic
902714861 1:18265675-18265697 AAGCATGTGGAGGTCAGGCAGGG - Intronic
904044106 1:27600054-27600076 CAGCCCCTGGAGGTGGGGGCCGG - Intronic
904702590 1:32366712-32366734 CAGCAAGTGGAGGTTAGGTCTGG - Intronic
906609170 1:47190253-47190275 CAGGGCATGGAGGTGAGGCTGGG - Intronic
906702412 1:47869558-47869580 CAGCATGGGGAGGTAAGGACTGG + Intronic
912687234 1:111777152-111777174 CAGCAGGTGGTAGTGAGGCCTGG + Exonic
915318392 1:155042680-155042702 CTGCACCTGGAGGACAGGCCCGG + Intronic
915604859 1:156944089-156944111 CAGCACGTGGAGGTCTGGAGGGG + Exonic
916588449 1:166167096-166167118 CCGCACGTGGGGCTGAGGCGGGG + Intergenic
917248025 1:173025560-173025582 AATCTCATGGAGGTGAGGCCTGG - Intergenic
918189699 1:182162385-182162407 CAGCATGTGGAGGTAGGCCCAGG + Intergenic
919066052 1:192693793-192693815 CAGCATGGGGACCTGAGGCCTGG + Intergenic
919747785 1:201019554-201019576 CTCCAAGTGGAGGTGAGGCGGGG - Intronic
920313175 1:205060417-205060439 AAGCATGTGGAAGTGGGGCCAGG + Intronic
921175900 1:212594193-212594215 CAGCCCCTGCAGATGAGGCCTGG + Intronic
922663774 1:227451915-227451937 CAGCAGGTGGAGGGGAGCCGAGG + Intergenic
924004029 1:239587172-239587194 CAGCACGTGGAGGTGAGGCCAGG - Intronic
924626696 1:245701809-245701831 CAGTACGAGGAGGAGAGGCGTGG - Intronic
1062794975 10:338325-338347 CGGCACCTGAACGTGAGGCCAGG - Intronic
1062950857 10:1502199-1502221 CAGCAGGTGCAGGAGGGGCCGGG - Intronic
1063312967 10:4972738-4972760 CAGAACGTGCAGGTGAGGAGCGG + Exonic
1063315026 10:4995308-4995330 CAGAACGTGCAGGTGAGGAGCGG - Exonic
1063325973 10:5102639-5102661 CAGAACGTGCAGGTGAGGAGCGG + Exonic
1063524445 10:6772011-6772033 CAGCACGTGAAGATGAGGGTGGG + Intergenic
1064611763 10:17110913-17110935 CAGCACCTGGTGGACAGGCCTGG + Exonic
1064823049 10:19361296-19361318 CAGCATGTGAATGTGAGGGCAGG + Intronic
1066692192 10:38041178-38041200 TAGCACATAGAGGTGAGGTCTGG + Intronic
1067539193 10:47139448-47139470 CAGCAGGAGGAAATGAGGCCTGG + Intergenic
1067771744 10:49131569-49131591 CAGGCCCTGGAGGTGAGGGCAGG + Exonic
1067803605 10:49377433-49377455 CTGCACGTGGGTGTGAGTCCTGG - Intronic
1067819783 10:49518564-49518586 CATCAAGTGGAGGTGGGGGCAGG - Intronic
1070747252 10:78941579-78941601 CAGCAAGAGGAATTGAGGCCTGG + Intergenic
1070773501 10:79096562-79096584 CAGCACGTGGAGGTGAGGGGTGG + Intronic
1071971845 10:90915843-90915865 CTGCATGTGGCGGTGAGGACTGG - Exonic
1072310011 10:94145667-94145689 CACCACCTGGAGGTGGGGCCAGG - Intronic
1072625332 10:97107723-97107745 CAGCACGTGGGGGTGGGGCAGGG - Intronic
1073550771 10:104398981-104399003 CAGGATGTGGGGGTGAGGACAGG - Intronic
1074102505 10:110364757-110364779 CAGCAGGTGGGGGTGGGGGCAGG - Intergenic
1074867585 10:117553861-117553883 CTGCAGGTGGAGGTGGGGGCAGG - Intergenic
1075087501 10:119423283-119423305 CAGCCCGGGGAGGACAGGCCAGG - Intronic
1075317626 10:121465478-121465500 CAGCACGAGGACGTGAGTCCTGG - Intergenic
1075739987 10:124689441-124689463 CAGGACCTGAAGCTGAGGCCTGG - Intronic
1076043353 10:127270167-127270189 GAGCCTGTGGAGGTGCGGCCAGG - Intronic
1076659575 10:132046559-132046581 CAGCACGAGGCGGTGAGGTTGGG - Intergenic
1077185151 11:1232415-1232437 CAGGGCGTGGAGATGAGGTCAGG + Intronic
1077241439 11:1512731-1512753 CAGCGCTAGGAGGTGGGGCCTGG + Intergenic
1077278576 11:1730458-1730480 CAGCAGGTGGATGTGAAGTCGGG + Intergenic
1077365782 11:2161045-2161067 AAGCATGTGGGGGTGAGCCCAGG - Exonic
1080748654 11:35132076-35132098 CAGAACATGGATGTGAGGCCAGG - Intergenic
1081869972 11:46378980-46379002 CAGCTCCTGGAGCTGAGGGCAGG - Exonic
1083661727 11:64254553-64254575 CTGCCCGTGGGGGTGGGGCCCGG + Intronic
1083685085 11:64370808-64370830 CAGAAAGGCGAGGTGAGGCCGGG + Intronic
1083728750 11:64642278-64642300 AAGCAGGTTTAGGTGAGGCCAGG + Intronic
1083767776 11:64850100-64850122 CAGCACGTGGAGGGCAGCCTTGG - Intergenic
1083777750 11:64902499-64902521 CAGAAGGTACAGGTGAGGCCTGG - Exonic
1083934546 11:65863435-65863457 CAGCCACTGGAGCTGAGGCCTGG + Exonic
1084672986 11:70618532-70618554 CATCACCTGCAGGTGAGGCCAGG - Intronic
1084717439 11:70882918-70882940 AGGCAGGTGGAGGTGAGGGCGGG + Intronic
1084734202 11:71093987-71094009 CAGCAGGGGAAGGTGAGGCGCGG + Intronic
1085041749 11:73330926-73330948 CAGCAGGTGGGGGTGGGGGCAGG + Intronic
1086559338 11:88149082-88149104 CAGGAGGTGGAGCTGAGGCAGGG - Intronic
1087024018 11:93632102-93632124 CAGCATGTGCAGGTGGGGCCTGG - Intergenic
1087732698 11:101796849-101796871 CAGTGGGTGGAGGTGGGGCCTGG + Intronic
1088480829 11:110295825-110295847 CAGCAGGTAGAGCTGCGGCCGGG + Intronic
1088596682 11:111446232-111446254 CAGTAATAGGAGGTGAGGCCAGG - Intronic
1088597357 11:111450357-111450379 CAGCACGTGGTGGGGAAGGCTGG - Intronic
1090077220 11:123587093-123587115 CAGCAGGTGAAGGGGAGGCTGGG - Intronic
1090274761 11:125411561-125411583 CAGAGAGTGGAGGTGAGGCTTGG - Intronic
1090424668 11:126599080-126599102 CAGCAAGGAGGGGTGAGGCCTGG - Intronic
1091273877 11:134337144-134337166 CAGAGCCTGGATGTGAGGCCAGG + Intronic
1091277416 11:134361941-134361963 CAGCACGAGAAGGGGAGGGCGGG - Intronic
1091586944 12:1821971-1821993 GAGCACGTGGAGCTGAGGCGGGG + Intronic
1091694113 12:2616559-2616581 CAGCAAGCGCAGGTGAGGTCTGG + Intronic
1091815183 12:3432303-3432325 CAGCCTGTGGAGGTGAACCCAGG + Intronic
1093720574 12:22437477-22437499 CAGCAGGTGGGGGTGGGGCTAGG - Intergenic
1096497644 12:52047642-52047664 CAGCTTGGGGAGGTGGGGCCTGG + Intronic
1097492127 12:60283085-60283107 CAGGAGGGGGAGGTGTGGCCAGG - Intergenic
1100297823 12:93278970-93278992 CAGTAAGGGGAGGTGGGGCCAGG + Intergenic
1100790754 12:98127423-98127445 CAGCATTGGGAGATGAGGCCCGG + Intergenic
1102225192 12:111223652-111223674 CAGCACATGGCGGAGAGGCCAGG + Intronic
1103932302 12:124457280-124457302 CAGCACGGGGGAGGGAGGCCCGG + Intronic
1104218952 12:126763404-126763426 CTGCACCTGCAGGTGAGGCAAGG - Intergenic
1104886837 12:132115236-132115258 CAGCACCTGGAGGTGACATCAGG + Intronic
1106094335 13:26629442-26629464 CAGCAGGTGGAGCTGTGGGCAGG - Intronic
1106480884 13:30136033-30136055 CTGCACTTGGAGGTCAGCCCTGG - Intergenic
1106568503 13:30906675-30906697 CAGCTCGTGGTGGCCAGGCCCGG + Exonic
1109076709 13:57845524-57845546 CATGACGTGGATGTGAGACCGGG - Intergenic
1112562911 13:100529597-100529619 CAGAAAATGGAGGTCAGGCCAGG + Intronic
1113693581 13:112329058-112329080 CGGCGAATGGAGGTGAGGCCAGG - Intergenic
1113800732 13:113085201-113085223 CAGCAGGTGCTGGGGAGGCCGGG - Intronic
1114623734 14:24115015-24115037 CACCACGTGGGCGTGAGGCGAGG + Exonic
1118900739 14:69983405-69983427 GAGCTCCAGGAGGTGAGGCCTGG - Intronic
1120824866 14:88945860-88945882 CAGAGGGTGGAGGAGAGGCCTGG + Intergenic
1121251586 14:92503763-92503785 GAGCAGGTGGAGGAGAAGCCAGG - Intergenic
1121345868 14:93135560-93135582 CAGCTCCTGGAGGTCATGCCCGG - Intergenic
1121715359 14:96070093-96070115 CTACAAGTGGAGGTGAGGTCTGG - Intronic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1122801412 14:104231566-104231588 CAGCACTTGGTGGTGGGGCCTGG + Intergenic
1122979250 14:105184257-105184279 CCACACGTGGAGCTGAGGACAGG + Intergenic
1123752051 15:23364253-23364275 GAGAAGGTGGAGGTGAGTCCTGG - Intronic
1123972058 15:25516437-25516459 CTGCACCTGGAGGTGAGGAAGGG - Intergenic
1124319531 15:28702813-28702835 GAGAAGGTGGAGGTGAGTCCTGG + Intronic
1124482981 15:30092618-30092640 GAGAAGGTGGAGGTGAGTCCTGG - Intronic
1124489432 15:30144689-30144711 GAGAAGGTGGAGGTGAGTCCTGG - Intronic
1124538061 15:30561619-30561641 GAGAAGGTGGAGGTGAGTCCTGG - Intronic
1124544521 15:30613680-30613702 GAGAAGGTGGAGGTGAGTCCTGG - Intronic
1125635004 15:41180336-41180358 CAGCAAGCTGAGATGAGGCCTGG - Intergenic
1126500329 15:49338300-49338322 CAGCTCTTGGAGGGCAGGCCTGG + Intronic
1126680996 15:51202084-51202106 CAGCAGGTCCAGGTGGGGCCTGG + Intergenic
1128237681 15:66079025-66079047 CAGGAGGTGGGGGTGAGGCAGGG - Intronic
1129867738 15:78922211-78922233 CAGAAAGAGGAGCTGAGGCCCGG + Intronic
1130897349 15:88181771-88181793 TGCCACGTGGAGGTGGGGCCTGG - Intronic
1131972004 15:97902837-97902859 CACCACGTGGAGATGAAGGCAGG - Intergenic
1132031836 15:98444841-98444863 CAGCACTAAGAGGCGAGGCCAGG - Intronic
1132283521 15:100641940-100641962 CTGCAAGTGGTGGTGGGGCCAGG + Intronic
1132592555 16:732500-732522 TAGCCCGTGGTGGGGAGGCCAGG + Intronic
1132936697 16:2484852-2484874 CAGCACGTAGGTGGGAGGCCTGG + Intronic
1133019467 16:2960827-2960849 CAGAGTGTGGAGGTGAGGCCTGG + Intergenic
1133401295 16:5489360-5489382 CAGCCCTTTGAGGTGAGCCCTGG - Intergenic
1136317335 16:29461939-29461961 CAGAAGGTCAAGGTGAGGCCGGG + Exonic
1136431910 16:30201282-30201304 CAGAAGGTCAAGGTGAGGCCGGG + Exonic
1136568139 16:31081917-31081939 CAGCACGTGGGGGCGTGGTCAGG + Intronic
1137665182 16:50245742-50245764 CTGCAGGGGGAGGGGAGGCCTGG + Intergenic
1138399013 16:56730505-56730527 CACGAGGTGGAGGTGAGGGCAGG - Intronic
1141570211 16:84929567-84929589 CAGGACGGGGAGGTGGTGCCTGG + Intergenic
1141991310 16:87612060-87612082 CAGCACCTGTGGGTGGGGCCCGG - Intronic
1142376082 16:89707809-89707831 CAGCCCTGGGAGGCGAGGCCAGG + Exonic
1142764165 17:2056438-2056460 CCGCCGGTGGAGGGGAGGCCAGG - Intronic
1143150831 17:4807059-4807081 AATCCCGCGGAGGTGAGGCCGGG + Intergenic
1143179049 17:4973019-4973041 ACGGAGGTGGAGGTGAGGCCAGG + Intronic
1143186220 17:5012121-5012143 CAGCTAGGGGAGGTGAGGCTTGG - Intronic
1143239927 17:5435270-5435292 CAGCACATGGCAGTGAGCCCTGG - Intronic
1143244190 17:5468941-5468963 CAGCACGTGGCGGCGAGGAAGGG - Exonic
1144761910 17:17711777-17711799 CAGCAGCATGAGGTGAGGCCCGG + Intronic
1146661168 17:34666009-34666031 CCGCAGGAGGAGGTGGGGCCTGG + Intergenic
1146894040 17:36528211-36528233 GATAACGTGAAGGTGAGGCCAGG + Intronic
1147321508 17:39648976-39648998 CAGCACCTGGAAGTGAGGCAAGG + Intronic
1147384466 17:40073096-40073118 CAGCTCCTGGGGGTGGGGCCAGG + Intronic
1148071922 17:44913717-44913739 ATCCACGAGGAGGTGAGGCCAGG - Exonic
1148890055 17:50800713-50800735 CAGCATGGGGAGGGAAGGCCGGG + Intergenic
1150474468 17:65464177-65464199 TACCACGTGAAGGTGAAGCCAGG - Intergenic
1151014623 17:70540058-70540080 TAAGAAGTGGAGGTGAGGCCGGG - Intergenic
1151691067 17:75685779-75685801 AAGCTCTTGGTGGTGAGGCCAGG - Intronic
1151882383 17:76903365-76903387 GGGAAGGTGGAGGTGAGGCCTGG + Exonic
1152196841 17:78923505-78923527 CAGCACGTGCTGGTGAGCCAAGG + Intronic
1152278774 17:79373065-79373087 CAGCAGGTGGGGCAGAGGCCTGG + Intronic
1152375282 17:79915692-79915714 CAGGAGGAGGAGGTGGGGCCAGG + Intergenic
1152825881 17:82464474-82464496 GAGGAAGTGGAGGTGAGGCCTGG + Intronic
1152861917 17:82701332-82701354 CAGAAGGTGGAGGTGAGGCCGGG + Intergenic
1153642141 18:7166305-7166327 GAGCACAAGGAGGTGAGGACAGG - Intergenic
1154136035 18:11779079-11779101 CAGCACGTAGAGGTGAGGAAGGG + Intronic
1157331099 18:46704519-46704541 GAGCATGTGGAGGTGGGGCAGGG - Intronic
1157539842 18:48492995-48493017 CACCATGTGGAGGAGAGGCGAGG - Intergenic
1157957774 18:52117827-52117849 GAGACCCTGGAGGTGAGGCCAGG - Intergenic
1159971978 18:74666286-74666308 CAGCCAGTGGAGGGGAGGGCAGG + Intronic
1160357554 18:78240968-78240990 AAACGCGTGGCGGTGAGGCCAGG - Intergenic
1160781313 19:878943-878965 GGGCACGTGGAGCTGCGGCCGGG - Intronic
1161211067 19:3065985-3066007 GAGCACGGTGAGGTGAGGGCTGG + Intergenic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1162502164 19:11060176-11060198 GAACAAGAGGAGGTGAGGCCGGG + Exonic
1163006254 19:14398372-14398394 AAGAACCTGGAGTTGAGGCCGGG + Intronic
1163266412 19:16225053-16225075 CAGCACGAGGAGGTGAGGCTGGG + Intronic
1163486127 19:17587320-17587342 AAGAACTTGGAGGTGATGCCTGG + Intergenic
1164760114 19:30722321-30722343 CTGCATGTGGAGGGAAGGCCTGG + Intergenic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1166259550 19:41627958-41627980 AAGGAGGTGGAGGTGAAGCCTGG - Intronic
1166326947 19:42056831-42056853 CAGGAAGAGGTGGTGAGGCCTGG + Intronic
1166828033 19:45621472-45621494 CAGGAAGTGGAGGTGAGGAGGGG - Exonic
1167104783 19:47423841-47423863 CAGAACGTGGAGGAGATGCCAGG + Intergenic
1167568099 19:50269683-50269705 CAACAGGTGGAGGTGACCCCTGG + Intronic
1168118531 19:54239670-54239692 CAGGACAGGGAGGTGAAGCCTGG + Intronic
1168121341 19:54254075-54254097 CAGGACGGGGAGGTGAGGGCTGG + Intronic
1168124853 19:54277607-54277629 CAGGACGGGGAGGTGAGGGCTGG + Intronic
1168132883 19:54332234-54332256 CAGGATGGGGAGGTGAGGGCTGG + Intergenic
1168177133 19:54633942-54633964 CAGGACGGGGAGGTGAGGGCTGG - Intronic
925401571 2:3576796-3576818 CAGCACGGGGAGGTGGAGGCGGG + Intronic
925639236 2:5971537-5971559 GAGCCCCTGCAGGTGAGGCCAGG - Intergenic
928421241 2:31138816-31138838 CTGCACGTGGCGCTGAAGCCGGG + Intronic
930031655 2:47061625-47061647 CACCAGGTAGAGGTAAGGCCAGG - Intronic
930312577 2:49759801-49759823 CAGGAAGTGGAGGTGAGCCAAGG + Intergenic
931951436 2:67367665-67367687 CATCAAGTGTAGGTGAGGACAGG - Intergenic
932430541 2:71671469-71671491 CAGCCCTTGTAGGTGAGCCCTGG - Intronic
932773911 2:74515859-74515881 CACCAAGTGGCGGTGAGGCGCGG + Exonic
936109066 2:109650351-109650373 CAAAAAGTGGAGGTGAAGCCAGG + Intergenic
936284625 2:111172772-111172794 CAGAGCGAGGATGTGAGGCCAGG + Intergenic
936827948 2:116604369-116604391 CATGACCTGGAGGTGAGACCTGG + Intergenic
937266993 2:120623027-120623049 CAGCACCTGGAGATGGGGCAGGG + Intergenic
937913317 2:127086848-127086870 CGCCATGTGGGGGTGAGGCCAGG - Intronic
939769572 2:146298909-146298931 CATCAGGTGGGGGTGAGGCTAGG - Intergenic
940582655 2:155601128-155601150 GAGCATGGGGAGGGGAGGCCTGG - Intergenic
941916464 2:170816934-170816956 AAGCAGCTGGAGGTGACGCCGGG + Exonic
943418215 2:187635700-187635722 AACCCCGTGGAGGTGAGGCAGGG + Intergenic
945214545 2:207419695-207419717 AAGCACATGGTGGTGGGGCCTGG - Intergenic
945957433 2:216099430-216099452 CAGCCCCTGGATGTGAGGGCTGG + Intronic
946400757 2:219467215-219467237 CAGGACGTGGACGTGGGGGCCGG + Exonic
946402695 2:219476896-219476918 GAGGACGTGGAGGTGGGGGCTGG + Exonic
948126990 2:235571440-235571462 CAGCACATGGCTGTCAGGCCTGG - Intronic
948412565 2:237775306-237775328 CAGCACGTGCAGGGGAGCTCGGG + Intronic
948885055 2:240878220-240878242 CACCAGGTGCAGGGGAGGCCGGG + Intronic
1169392198 20:5199232-5199254 CAGCAGATGGAGTTGAGCCCAGG - Intergenic
1169406740 20:5327517-5327539 CAGGAGGGGGAAGTGAGGCCTGG - Intergenic
1171449738 20:25226968-25226990 CAGCACGGCCAGGTGAGGCCTGG + Intergenic
1173170704 20:40721280-40721302 AAGCTCTGGGAGGTGAGGCCCGG - Intergenic
1173810543 20:45952587-45952609 CACCACATTGAGGTGAGGCTTGG - Exonic
1174539063 20:51275099-51275121 CAGAACCTGGGGGTGAGGGCGGG + Intergenic
1175688664 20:61049915-61049937 CAGCAGCTGGAGGTGGGGCTCGG + Intergenic
1175998057 20:62820164-62820186 CCATACGTGGAGGTGAGGCAGGG - Intronic
1176159429 20:63640971-63640993 CAGCACGTGCAGGTCAGGGCAGG - Exonic
1176187616 20:63789754-63789776 CAGCACGCGGCCGTGAGGCCTGG + Intronic
1176232084 20:64037894-64037916 CAGCAGGTTGGGGTTAGGCCTGG - Intronic
1177936681 21:27356412-27356434 CAGAGCCTGGAGGTGAGGCAGGG + Intergenic
1177995348 21:28089907-28089929 CATCAGGTGGAGGTGGGGCTAGG + Intergenic
1178860192 21:36282574-36282596 CAGCACCTTCAGCTGAGGCCAGG + Intronic
1179238308 21:39566532-39566554 CTGGACCTGGAGGTGAGGCAGGG + Intronic
1180126237 21:45792113-45792135 AAGCAGTTGGAGGCGAGGCCCGG + Intronic
1180128243 21:45806331-45806353 AGGGAAGTGGAGGTGAGGCCAGG + Intronic
1180891390 22:19291589-19291611 GAGCACTTCCAGGTGAGGCCCGG - Exonic
1180956528 22:19743760-19743782 CAGGAGGTGGCAGTGAGGCCAGG + Intergenic
1180981508 22:19880168-19880190 GAGCATGTTGAGGTGAGGCCTGG - Exonic
1181778937 22:25178942-25178964 CAGCACGTGCAGGTCAGGGCAGG - Intronic
1181839814 22:25647170-25647192 CGGTGGGTGGAGGTGAGGCCCGG - Intronic
1182295755 22:29310621-29310643 CAGCACCTGCAGGTGTGGGCAGG - Exonic
1182331783 22:29556056-29556078 CAGCATGTGTGGGTGGGGCCAGG - Intronic
1182442445 22:30372275-30372297 CGCCACCAGGAGGTGAGGCCAGG + Exonic
1182670755 22:31993824-31993846 CAGAAGCTGGAGGAGAGGCCAGG - Intergenic
1182776947 22:32838309-32838331 CAGGACCTGGAGATGGGGCCTGG + Intronic
1182932795 22:34191110-34191132 CAGCACGTAGAAGGGGGGCCTGG - Intergenic
1183095276 22:35548202-35548224 CAGCACCTGGGTGTGAGCCCTGG + Intronic
1183629093 22:39022376-39022398 CAGCACTTAGAAGAGAGGCCTGG + Intronic
1184236519 22:43186149-43186171 CAGCACCTGGAGGAGATGTCGGG + Intronic
1184286971 22:43477339-43477361 CAGGTGGTGGAGGTGAGACCTGG + Intronic
1184364587 22:44042010-44042032 CATCAGGTGGAGAAGAGGCCTGG + Intronic
1184480415 22:44743448-44743470 CAGCAGGTAGACGTGTGGCCTGG + Intronic
1184784487 22:46665142-46665164 CAGGGGATGGAGGTGAGGCCTGG - Intronic
1184979183 22:48084146-48084168 CATCACGTGGAGGGGCTGCCGGG + Intergenic
1185317746 22:50186156-50186178 CAGGTCGTGGGGGTCAGGCCCGG + Intronic
1185317765 22:50186208-50186230 CAGGTCGTGGGGGTCAGGCCAGG + Intronic
1185317824 22:50186357-50186379 CAGGTCGTGGGGGTCAGGCCCGG + Intronic
949255943 3:2046218-2046240 CAGCACATGGAGCTGAGGCCAGG - Intergenic
950150203 3:10680880-10680902 CTCCATGTGGAGGTGGGGCCTGG + Intronic
952219919 3:31314807-31314829 CAGAAGGTGGAGGAGAGGCAAGG - Intergenic
953404592 3:42654239-42654261 CAGCACGGGAGGGTGGGGCCGGG + Intronic
953690871 3:45117955-45117977 CAGAAGGTTGAGGAGAGGCCGGG - Intronic
954876660 3:53806842-53806864 AAGCAGATGCAGGTGAGGCCGGG + Intronic
955291041 3:57692771-57692793 CAGGCCGTGGAGGTGAGGCCCGG - Exonic
955365487 3:58306579-58306601 CAGAACGTGGCCGAGAGGCCCGG + Intronic
955499931 3:59573430-59573452 CAGCTCGTGGAGCTGAGGAGGGG - Intergenic
956074411 3:65489497-65489519 CAGAAGGGGGAGGTGAGGCAGGG + Intronic
956659572 3:71584102-71584124 CAGCAGGTGGATGTGACGTCAGG - Intergenic
959046975 3:101485136-101485158 CATCAGGTGGAGGTGGGGCTAGG - Intronic
963438625 3:145307131-145307153 TGGCCTGTGGAGGTGAGGCCAGG - Intergenic
963622933 3:147634961-147634983 CAGCACCTGAAGGTGTGGGCAGG + Intergenic
964616589 3:158672784-158672806 CAGCAGGTGGAGGTGTGGGGAGG + Intronic
968433854 4:575285-575307 CGGCAGGCGGAGGGGAGGCCGGG - Intergenic
968450846 4:675275-675297 CAGAACGTGGAGGGGGTGCCAGG - Intronic
968673862 4:1866521-1866543 CAGCACCTGGAGTTGGGGCCTGG + Intergenic
969691749 4:8707695-8707717 CAGCAAGGTGTGGTGAGGCCAGG - Intergenic
975214520 4:71738198-71738220 CAGCACATGGAGCCTAGGCCTGG - Intergenic
975804666 4:78099416-78099438 CTGCAAGTGGAGGGGAGGACTGG - Intronic
976733144 4:88284169-88284191 CAGCTCGTCGGGGTGAGGCGGGG - Intronic
977885204 4:102245346-102245368 CAGCACCTGTTGGGGAGGCCTGG - Intergenic
981861561 4:149362020-149362042 CATGACCTGGAGGTGAGACCTGG + Intergenic
983466390 4:168097697-168097719 CAGTACCTGGAGGTGGGACCAGG - Intronic
984807673 4:183766501-183766523 GTGCACCAGGAGGTGAGGCCTGG + Intergenic
985534317 5:455080-455102 CAGCCAGGGGAGGTGAGTCCAGG - Intronic
986412585 5:7495190-7495212 CAGAACATGGAGGTGAGGCACGG - Intronic
991490744 5:67180524-67180546 CAGTATCTGGGGGTGAGGCCTGG + Intergenic
994895532 5:105697754-105697776 CAGGACATGGACGTGAGACCTGG - Intergenic
995312621 5:110731168-110731190 CATGACCTGGAGGTGAGACCTGG - Intronic
996222881 5:120954204-120954226 CATGACCTGGATGTGAGGCCTGG + Intergenic
997229827 5:132234234-132234256 CAGCAGCTGGAGGTGTGGTCAGG + Intronic
997259369 5:132454319-132454341 CAGGGTGTGGAGGTGAGACCTGG + Intronic
997262753 5:132476875-132476897 GAGCACTTGGAGGGGAGCCCTGG + Intergenic
998060357 5:139114234-139114256 GAGCAGGTGGAGGCCAGGCCAGG - Intronic
998092614 5:139380096-139380118 CAGGAAGTGGATGGGAGGCCAGG + Intronic
1000564818 5:162834581-162834603 CATGACCTGGATGTGAGGCCTGG - Intergenic
1001159718 5:169301916-169301938 CAACCCAGGGAGGTGAGGCCAGG - Intergenic
1001310103 5:170604300-170604322 CATCTGGTGGAGGTGAGGTCAGG + Intronic
1001752476 5:174142240-174142262 CAGAACGTGGAGGAAAGGCTCGG - Intronic
1002211614 5:177602709-177602731 GAGCACCTGGAGTTGGGGCCAGG + Intronic
1002553980 5:180019968-180019990 CAGGACGGAGAGGTGAAGCCAGG + Intronic
1003882393 6:10490440-10490462 CAGCATCTGAAGGTGGGGCCTGG - Intergenic
1003964084 6:11236646-11236668 CAGCAATTGGTGGTGAGGTCAGG + Intronic
1005972132 6:30769684-30769706 GGGCCCGTGGAGGTGAGGCTGGG - Intergenic
1006583264 6:35088707-35088729 CTGCAGGCGGAGGTGAGGCCTGG - Exonic
1006614980 6:35320006-35320028 GAGGATGTGGAGGTGAGGCCTGG + Exonic
1006630539 6:35427157-35427179 GAGCAGGGGGATGTGAGGCCAGG - Exonic
1006729195 6:36223058-36223080 CAGGACCTGGGGGAGAGGCCTGG + Intronic
1007183095 6:39944905-39944927 CAGAAGATGGAGGGGAGGCCTGG - Intergenic
1008037879 6:46765152-46765174 TAGCACGCGGACGTGAGGCCAGG - Intergenic
1008160371 6:48068786-48068808 GAGCGCATGGAGGTGGGGCCGGG - Intergenic
1010032766 6:71288444-71288466 CAGCTCCTGGAGCTGAGGACTGG - Intergenic
1012258506 6:97061108-97061130 CACCACCTGGAGGTCAGGCGGGG + Intronic
1012932396 6:105330593-105330615 CAGCAAGTGGAAGTGAGGACAGG + Intronic
1014356719 6:120420775-120420797 CAGAACGTGAAGGTGAAGCAAGG + Intergenic
1016122727 6:140364003-140364025 CAGCACGAGGACCTTAGGCCAGG - Intergenic
1016665227 6:146631835-146631857 CACCTCCTGGAGGTGAGGGCTGG - Intronic
1017712195 6:157180932-157180954 CAGCATGTGGAGGTGGGGCATGG - Intronic
1017972427 6:159324826-159324848 CAGAACATGGAAGTGAGGCATGG - Intergenic
1018621437 6:165732899-165732921 CAGCACGCGAAGGAGAGCCCTGG - Intronic
1018862787 6:167723018-167723040 CAGGAGGTGGAGGTGGGGCCTGG + Intergenic
1019119046 6:169789092-169789114 CAGGACGTGTGGGTGGGGCCAGG + Intergenic
1019348781 7:543416-543438 GAGCCAGGGGAGGTGAGGCCGGG + Intergenic
1019420666 7:949274-949296 CGGCACGTGGCCGTGTGGCCAGG - Intronic
1019494311 7:1330571-1330593 CTGGAGGTGGAGGTCAGGCCCGG + Intergenic
1019557719 7:1640996-1641018 GAGGAGGTGGAGGGGAGGCCAGG - Intergenic
1021311798 7:19106477-19106499 CAGGACCGCGAGGTGAGGCCAGG - Intronic
1026854449 7:73743750-73743772 CAGCAGGTGCGGGTGAGGCAGGG - Intergenic
1029490579 7:100867977-100867999 CAGCACACGCAGGTGAGACCCGG + Exonic
1029705153 7:102272217-102272239 GAGCATGTGGGGGTGAGGCTGGG + Intronic
1032072418 7:128816452-128816474 CAGGACATGAAGGTGGGGCCTGG + Intronic
1033653683 7:143360174-143360196 CTGCACAGGGAGGTGAGGGCCGG - Intronic
1035068495 7:156124555-156124577 CAGCACAAGGAGGTGGGGGCGGG - Intergenic
1035174689 7:157041990-157042012 GAGCAGGGGAAGGTGAGGCCAGG - Intergenic
1035313678 7:157984927-157984949 CAGCACGGGGTGGGGAAGCCAGG - Intronic
1035645248 8:1214046-1214068 AACCACATGGAGGTGAGGACAGG - Intergenic
1036183953 8:6608221-6608243 AAGCACGGGCAGGTGAGGCCTGG - Intronic
1037402298 8:18505146-18505168 CAGGACATGTAGGTAAGGCCTGG + Intergenic
1039372057 8:36995024-36995046 TTGCAGGTGGAGGTAAGGCCTGG - Intergenic
1041117142 8:54550857-54550879 GAGCAGGTGGAGGTGAGGTCTGG - Intergenic
1041224750 8:55687185-55687207 TTGCACGTGGATGTGAGCCCTGG - Intergenic
1042175947 8:66037070-66037092 TAGCATCTGGAGGTGAGGCCTGG + Intronic
1042201601 8:66284200-66284222 CAGCACCAGGAAGTGAGGACAGG + Intergenic
1049065104 8:140307190-140307212 TAGCAAGAGGATGTGAGGCCTGG + Intronic
1049616158 8:143576635-143576657 CAGCGTGTGGAGGTGAGCCCGGG - Exonic
1049683552 8:143930373-143930395 AAGCAGGTGGAGGTGAGCGCAGG - Exonic
1049729926 8:144171353-144171375 CAGCAGGTGGAGGAGACGCTTGG + Intronic
1050351162 9:4741770-4741792 CGCCAGGTGGAGGTGGGGCCAGG - Intronic
1053146409 9:35715048-35715070 CAGCGCCTGGAGGTGAGGCTGGG - Exonic
1054790057 9:69248213-69248235 CAGCACGAGGAGGTGAGGCGAGG + Exonic
1056170439 9:83980108-83980130 CGGCTCGTGGAGGTGAGGGTCGG - Intronic
1057308308 9:93925254-93925276 CTGCTGGTGGGGGTGAGGCCTGG - Intergenic
1057922009 9:99105234-99105256 CAGCACGAGGAGGAGCAGCCGGG - Exonic
1058475069 9:105324541-105324563 CAGCACTTGGAGGCCAGGCGTGG - Intronic
1058882330 9:109296588-109296610 CAGAAGAGGGAGGTGAGGCCAGG + Intronic
1059339386 9:113589090-113589112 AAGCAGATGGAGGTGAGTCCAGG - Intronic
1060269810 9:122132455-122132477 CAGCAAGTGGAAGGGAGGCAGGG - Intergenic
1060440408 9:123633280-123633302 GAGAACATGGAGGTGAGGACAGG - Intronic
1060587894 9:124797951-124797973 CAGCAAGGGGAGATGAGGCAGGG + Intronic
1060731492 9:126039700-126039722 CAGCCCGGGGAGCTGAGGCTGGG - Intergenic
1060733652 9:126052804-126052826 CCCCAGGTGGAGATGAGGCCGGG + Intergenic
1060965053 9:127707545-127707567 CAGGAAGTGGAAGTGGGGCCTGG - Intronic
1061045781 9:128164080-128164102 CAGAAGGTGCAGGTGAGGGCAGG + Intergenic
1061296565 9:129679923-129679945 CAGCAAGTGGAGCTGAGGTTGGG - Intronic
1061682691 9:132250776-132250798 CAGCACGTGGTGGGGTGGCTGGG + Intergenic
1061816441 9:133200064-133200086 CAGCACCTGGACCTGAGCCCGGG + Intergenic
1061955175 9:133957546-133957568 CAGGGCGAGGAGGGGAGGCCAGG + Intronic
1062193251 9:135258487-135258509 CAGCTGGTGGAGGTGGGGCAGGG - Intergenic
1185672639 X:1824868-1824890 CTGAAGTTGGAGGTGAGGCCAGG - Intergenic
1185672735 X:1825332-1825354 CTGAAGTTGGAGGTGAGGCCAGG - Intergenic
1189649882 X:43177558-43177580 CAGCTAGGGGAGGGGAGGCCAGG - Intergenic
1190102097 X:47529649-47529671 CAGCAGCTGGAGGAGAGGCCTGG - Intergenic
1190430376 X:50372848-50372870 CAGGGAGTAGAGGTGAGGCCAGG - Intronic
1194566490 X:95494783-95494805 CATCAAGTGGATGTGAGACCTGG + Intergenic
1198940853 X:141953456-141953478 CAGCAGGAGGAGATGAGTCCTGG + Intergenic
1201304791 Y:12541382-12541404 CAGGGCTTGGAGGAGAGGCCTGG + Intergenic