ID: 924007824

View in Genome Browser
Species Human (GRCh38)
Location 1:239631600-239631622
Sequence CTAGGTTAACCTTCTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924007816_924007824 26 Left 924007816 1:239631551-239631573 CCACAGTTCCCCTGTTCTTCTGC 0: 1
1: 0
2: 4
3: 32
4: 362
Right 924007824 1:239631600-239631622 CTAGGTTAACCTTCTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 46
924007820_924007824 16 Left 924007820 1:239631561-239631583 CCTGTTCTTCTGCAAAGCCTGGC 0: 1
1: 0
2: 0
3: 22
4: 239
Right 924007824 1:239631600-239631622 CTAGGTTAACCTTCTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 46
924007818_924007824 17 Left 924007818 1:239631560-239631582 CCCTGTTCTTCTGCAAAGCCTGG 0: 1
1: 0
2: 0
3: 33
4: 266
Right 924007824 1:239631600-239631622 CTAGGTTAACCTTCTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 46
924007817_924007824 18 Left 924007817 1:239631559-239631581 CCCCTGTTCTTCTGCAAAGCCTG 0: 1
1: 0
2: 2
3: 20
4: 323
Right 924007824 1:239631600-239631622 CTAGGTTAACCTTCTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 46
924007821_924007824 -1 Left 924007821 1:239631578-239631600 CCTGGCACTTCTTTTTCTTTCTC No data
Right 924007824 1:239631600-239631622 CTAGGTTAACCTTCTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924007824 Original CRISPR CTAGGTTAACCTTCTAATGG AGG Intronic
901620398 1:10581003-10581025 CTATGTTATGCTTCTAGTGGAGG + Intronic
909785397 1:79605280-79605302 TGAGGGTAACCATCTAATGGTGG + Intergenic
911409924 1:97490652-97490674 CTAAGTTCACCTTCTGGTGGGGG - Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915205753 1:154269283-154269305 TTAGCTTTCCCTTCTAATGGTGG + Intronic
918749242 1:188251425-188251447 CTAGCTTAATCTTTTAATGGGGG - Intergenic
920730542 1:208479724-208479746 CTAGGAAAACCAGCTAATGGAGG - Intergenic
924007824 1:239631600-239631622 CTAGGTTAACCTTCTAATGGAGG + Intronic
1063573666 10:7241180-7241202 CTGGGTTAACCTCCTAATCATGG - Intronic
1073570598 10:104577864-104577886 CTGGGTTAGCTTTCTAATGGAGG + Intergenic
1078485692 11:11721311-11721333 CTACCTTAAACATCTAATGGAGG + Intergenic
1079591758 11:22191641-22191663 CTAGATTCACTGTCTAATGGCGG - Intergenic
1082958541 11:58897331-58897353 GCAGGTTACCCTTCTCATGGTGG - Intronic
1090812680 11:130260472-130260494 TTAGGTTAATCATCTAATTGGGG - Intronic
1106866421 13:33969302-33969324 CAAGGTTCACCTTCAAAGGGTGG - Intergenic
1112454641 13:99547899-99547921 CTAAGTTAATCTTTTACTGGGGG - Intronic
1115596217 14:34912099-34912121 GTAGGTTAAAATGCTAATGGAGG + Intergenic
1119797514 14:77412462-77412484 CTGGGGTAACCTTCTACTGTGGG + Intronic
1140581858 16:76240356-76240378 CTAGGTAAACTTTGTCATGGGGG - Intergenic
1141742949 16:85906419-85906441 CTAAGTTGACCTTTTAATGCTGG + Intronic
1147163567 17:38581515-38581537 CTGGTTTGACCTTCTAATTGGGG - Intronic
1147596120 17:41718557-41718579 CTAGGTTAGACTTCCAAGGGTGG + Intronic
1147713823 17:42490436-42490458 TTAGGTTATCCTCCTAATTGTGG - Intronic
940472900 2:154121249-154121271 CTAGGTGAACTTTCTGTTGGGGG + Intronic
1179644255 21:42765969-42765991 CTAAGTGCACCTTCTCATGGGGG - Intronic
965888740 3:173482878-173482900 CTAAGTTACCCTTCTAATTCTGG - Intronic
967010557 3:185429120-185429142 ATAGGTTATCCAGCTAATGGTGG - Intronic
976155477 4:82139654-82139676 CAAGGTGGACCTTCTAATGGTGG - Intergenic
978946799 4:114508983-114509005 CTAGTTTAACTTTCTAGAGGAGG + Intergenic
979213076 4:118130600-118130622 CTATGATAACATTGTAATGGTGG - Intronic
994384690 5:99116816-99116838 CTAGATTAACCATTTAATTGTGG + Intergenic
996714907 5:126579326-126579348 CTTGGCTAACCTTCTCTTGGAGG + Intronic
1001120845 5:168978847-168978869 CAGGGTTAAGCTTCCAATGGAGG - Intronic
1008481698 6:51992923-51992945 CTAGTTTTACATTTTAATGGGGG - Intronic
1015902974 6:138086378-138086400 CTAGATTATGATTCTAATGGTGG + Intergenic
1016000252 6:139034175-139034197 CGAGGTTAACCTCTTAGTGGAGG + Exonic
1024482002 7:49873334-49873356 CTATGTCCACCTTGTAATGGAGG + Intronic
1025104710 7:56161644-56161666 ATATGTTAACCTACTAATAGAGG - Intergenic
1028927564 7:96375751-96375773 CTAGTGTAACTTTGTAATGGAGG + Intergenic
1032123851 7:129176435-129176457 CTAAGTTTACATTCTACTGGAGG + Intergenic
1042088026 8:65129868-65129890 ATATTTTAACCTTCTAATGTAGG + Intergenic
1044119583 8:88378187-88378209 CTAGCATAATCTTTTAATGGTGG + Intergenic
1044370603 8:91405934-91405956 CTAGCTTAAACTTCTTATGGTGG + Intergenic
1056403268 9:86248799-86248821 CTAGGTCAACCTTCTCATCAAGG + Intronic
1187028208 X:15457776-15457798 CTTGTTAAACCTTCTAATGTAGG + Intronic
1188546762 X:31316020-31316042 CTAGTTCAACCTTCTCATTGAGG + Intronic
1197066922 X:122244710-122244732 CTGGTTTAAGCTTCTATTGGAGG - Intergenic