ID: 924008231

View in Genome Browser
Species Human (GRCh38)
Location 1:239635809-239635831
Sequence CTAAGCCTCTTGCAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924008231 Original CRISPR CTAAGCCTCTTGCAGGGGGC AGG (reversed) Intronic
900089127 1:911716-911738 CTCAGCCTCGTGCAGAGGGAGGG + Intergenic
901082753 1:6592843-6592865 GTAAGCCCCTGGCAGGGGCCAGG + Exonic
902135003 1:14297553-14297575 TAAAGGATCTTGCAGGGGGCAGG - Intergenic
902373427 1:16018940-16018962 CGAAGCCTCTTGGAAAGGGCGGG + Intronic
902562204 1:17284586-17284608 CGCAGCCTCTTGCAGGCGGAAGG - Intergenic
903739117 1:25548032-25548054 CCAAGCCCCTTGCTGGGGTCAGG - Intronic
904836666 1:33342133-33342155 CTGAGTTCCTTGCAGGGGGCTGG + Intronic
905031452 1:34886542-34886564 CTATGCCTCTTCCAGGTGTCTGG + Intronic
905478341 1:38244445-38244467 CAAAGCCTCGTGCATGGGGAAGG + Intergenic
906707727 1:47906981-47907003 CCAAGCCTATTCCAGGGAGCAGG - Intronic
907192037 1:52657458-52657480 GTAAGCCCCTTGCAGAGGGACGG + Intronic
907404786 1:54247258-54247280 CCAAGCATCTTGCAGGAGGCAGG + Intronic
908092349 1:60699496-60699518 TAAAGCCTCCTGCAGTGGGCAGG - Intergenic
908755895 1:67468445-67468467 CTAAGCCTGGGGCAGTGGGCAGG + Intergenic
916729584 1:167553844-167553866 CTAAGCACAATGCAGGGGGCGGG + Intergenic
920194903 1:204220360-204220382 GAAAGCATCTTGCCGGGGGCAGG - Exonic
920836046 1:209512089-209512111 CAAAGCTTATTGCAGGGGGTGGG + Intergenic
924008231 1:239635809-239635831 CTAAGCCTCTTGCAGGGGGCAGG - Intronic
1068742132 10:60485526-60485548 CTAAACCTCTGGGAGAGGGCAGG + Intronic
1070790610 10:79187142-79187164 TTAACACTCTTGCAGGAGGCTGG - Intronic
1070991788 10:80739622-80739644 CTAAGCCTCTAGAAAGGGGGAGG + Intergenic
1071201373 10:83223049-83223071 CTATGCCACTTGCAGGGGTCAGG - Intergenic
1072533220 10:96339067-96339089 CTATGCCTCCTGGAGGAGGCAGG - Intergenic
1074106429 10:110392837-110392859 CTGAGCCTCTAGCAAGGGTCTGG - Intergenic
1074857745 10:117485908-117485930 CTCTGCCACTTGCAGGTGGCAGG - Intergenic
1075399172 10:122149347-122149369 CTGAGCTTCTTGCAGGGAGGAGG + Intronic
1076709347 10:132323178-132323200 GTAAGCCTATTGTAAGGGGCAGG - Intronic
1079008629 11:16810489-16810511 CCAAGCCTCTTCCAGGCTGCTGG + Intronic
1079402660 11:20118345-20118367 CTAAGGCTGTGGCTGGGGGCTGG - Exonic
1084640115 11:70420756-70420778 CCAAGCCTGCAGCAGGGGGCTGG + Intronic
1084829759 11:71759889-71759911 CTAAGTTTGTTGCAGGGGTCGGG - Intergenic
1086324659 11:85686061-85686083 CTAAGCGTTCTTCAGGGGGCGGG + Exonic
1088689751 11:112315612-112315634 CTGACCCTCCTGCAGGAGGCTGG - Intergenic
1089145827 11:116329108-116329130 CTAAGGCTCATGAAGAGGGCTGG - Intergenic
1091601802 12:1922395-1922417 CTAAGCCTCGGGGAGGGGGACGG + Intergenic
1092132695 12:6123728-6123750 CTAAGCATCTTGCCAGGTGCTGG - Intronic
1092906898 12:13109120-13109142 CTTAGCCTCCTGCAGGTAGCTGG + Intronic
1093006581 12:14058074-14058096 CTAAGCCACTTGGAGGCGTCTGG + Intergenic
1096101904 12:48974560-48974582 CTAACCCTATTCCAGGGGGGTGG + Intergenic
1096229622 12:49889738-49889760 CTAAGCCTGTTGGGAGGGGCAGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099817539 12:87668410-87668432 CAAAGGCTCTTGCAGGGGCCTGG + Intergenic
1101217263 12:102596691-102596713 CTATGCCACTTGCAGGGAACAGG - Intergenic
1108566378 13:51702484-51702506 ATAAGCTTCTTAAAGGGGGCTGG + Intronic
1112196110 13:97228052-97228074 CTAAGCCTGTTACAGGGAGTTGG + Intronic
1112567609 13:100564809-100564831 CTATGCCCCGGGCAGGGGGCGGG + Intronic
1112617877 13:101023993-101024015 CTAAGATTCTTTCAGAGGGCAGG + Intergenic
1115474137 14:33798168-33798190 CAATGCCTCTTTCAGGGTGCTGG + Intronic
1117015225 14:51510984-51511006 ATAGGCCTCTTGGCGGGGGCGGG - Intronic
1119473853 14:74915906-74915928 CTGAGCCTCGTGCAGGAGCCAGG - Intronic
1120827732 14:88970432-88970454 CAAGGCCTCTTGCAGGTGCCTGG - Intergenic
1121779576 14:96613756-96613778 CCAAGCACCCTGCAGGGGGCTGG - Intergenic
1122641806 14:103164424-103164446 CTATGCCACTTGCAGGGGAGAGG + Intergenic
1124347269 15:28931095-28931117 CTGTGCCTCATGGAGGGGGCTGG - Intronic
1126477378 15:49079764-49079786 CTGAGCCCCTGGCAGGGGTCGGG - Intergenic
1128964126 15:72040394-72040416 CTATGCCATTTGCAGGGGGGAGG + Intronic
1129149331 15:73677844-73677866 CTAAGCCTCCTCCAAGGAGCAGG - Intergenic
1129301014 15:74625574-74625596 CTAAGCTTCCTGCGGGGGGTAGG - Intronic
1129608163 15:77034890-77034912 CTAAGCCTGGTGCAGGGGCAGGG + Intronic
1129666593 15:77582738-77582760 CTAGGCCAGTTGCAGGGGGCTGG + Intergenic
1132610146 16:811819-811841 CTCAGCCTCTCGCATGGGACTGG - Intronic
1134036936 16:11038118-11038140 CTTAGCCTCTTTCTGGGAGCTGG + Intronic
1134053169 16:11151806-11151828 CTCAGCCACTTTCGGGGGGCGGG + Intronic
1134061708 16:11203165-11203187 CTGAGTCCCTTGCAGGGGGCAGG - Intergenic
1134503982 16:14790736-14790758 CTCAGCATCTGGCAGGGGCCTGG - Intronic
1134576590 16:15338172-15338194 CTCAGCATCTGGCAGGGGCCTGG + Intergenic
1134679693 16:16115680-16115702 TTAAGCCTCCTGCAGGAGGCAGG + Intronic
1134725849 16:16418327-16418349 CTCAGCATCTGGCAGGGGCCTGG - Intergenic
1134856693 16:17525893-17525915 CTAAGCCTCCTGCAGCGCACAGG + Intergenic
1134941584 16:18293532-18293554 CTCAGCATCTGGCAGGGGCCTGG + Intergenic
1138194214 16:55040567-55040589 CTGAGCCTCGTTCAGGGTGCGGG + Intergenic
1140890355 16:79279603-79279625 CTGAGCCACTTGCAGGGGTGAGG - Intergenic
1141635564 16:85312192-85312214 CTGATCCTCTTGCGGGGGGGGGG + Intergenic
1141768514 16:86074552-86074574 CGAAGCTTCTGGCAGGGGCCTGG - Intergenic
1142194915 16:88734867-88734889 CTCACCCTCTTCCAGGTGGCTGG - Exonic
1143275200 17:5705221-5705243 CCAACTCTCCTGCAGGGGGCAGG + Intergenic
1144024144 17:11262671-11262693 CTGGACCTCTTGCAGGGGGGCGG + Intronic
1144838707 17:18172342-18172364 CTTGGCCTCTTGGAGGGGGTTGG - Intronic
1147251362 17:39154339-39154361 CTGAGCCACTGGCAGGGGCCAGG + Intronic
1147770787 17:42866631-42866653 CAAAGCATCTAGCAGGGAGCTGG - Intergenic
1148125255 17:45233382-45233404 CACAGCCTTGTGCAGGGGGCAGG - Intronic
1150287451 17:63962124-63962146 CTGGGCCTCTGGCAGGGGGTGGG - Intronic
1150454220 17:65294111-65294133 ATCAGCCTCGTGCAGGGGGCTGG + Intergenic
1154471737 18:14709794-14709816 CTTAACCTCTTGCAGAGGGTGGG + Intergenic
1156105390 18:33653296-33653318 CTAAGAATCTTGCAGGGGGCAGG + Intronic
1160263274 18:77315611-77315633 CTAGGCCTACTGCAGGGTGCAGG - Intergenic
1161260847 19:3337042-3337064 CTAGGCCTCTTCCAGGAGGGAGG + Intergenic
1162306145 19:9875338-9875360 TCATGCCTCTGGCAGGGGGCAGG + Intronic
1165487707 19:36105367-36105389 CTCAGGCACTGGCAGGGGGCAGG - Intergenic
932571952 2:72942832-72942854 CCAGGCCTCTGGCAGGGGGAGGG + Exonic
935487292 2:103673357-103673379 AGAAGCCTCCTGCATGGGGCAGG + Intergenic
938169550 2:129062785-129062807 CTGCGTCTCTTGGAGGGGGCAGG + Intergenic
943383663 2:187177847-187177869 CTATGCCACTTGCAGAGGACAGG - Intergenic
946183708 2:217964911-217964933 CAATGCCCCTTGCAGCGGGCAGG - Intronic
946365125 2:219244325-219244347 CTCAGCCTCTAGCACAGGGCCGG + Intronic
948162490 2:235836544-235836566 CTAAGCGCCTTGCAGCAGGCTGG - Intronic
1170645122 20:18190962-18190984 CTAAGCCTTGGGGAGGGGGCTGG + Intergenic
1170998995 20:21395744-21395766 GTGAACCTCTTGCTGGGGGCGGG - Exonic
1174139203 20:48400892-48400914 CTGAGCCTCTGCCAGGAGGCCGG + Intergenic
1174205999 20:48839662-48839684 CCAGGCCTCTTGCAGGTGGGTGG + Intergenic
1174286518 20:49477898-49477920 CCAAGCCACTTGCAGGGGTTGGG + Intronic
1174386234 20:50190102-50190124 CCAAGCCTCGAGCAGGCGGCAGG + Intergenic
1176802751 21:13448119-13448141 CTTAACCTCTTGCAGAGGGTGGG - Intergenic
1178781734 21:35609764-35609786 TGAAGGCTCTTGCAAGGGGCTGG + Intronic
1179955343 21:44735178-44735200 CCCAGCCTCCTGCAGGGGCCAGG + Intergenic
1180021539 21:45131524-45131546 CTAAACCTCCTGGAGGGAGCAGG - Intronic
1181510504 22:23386789-23386811 CTAAGCCGCTCCCAGGGTGCGGG - Intergenic
1181989949 22:26829740-26829762 CTCAGCATCTTGCAGGGAGCTGG - Intergenic
1182456478 22:30454157-30454179 TTCAGCATCTTGCAGGAGGCTGG - Intronic
1183687049 22:39367196-39367218 CTCAGCCTCTTGCACAGGGCTGG + Intronic
952963864 3:38609261-38609283 CCAACCCTCTTGCAGGGTTCTGG + Intronic
953440423 3:42911334-42911356 CTATGCCCTTTGTAGGGGGCTGG - Intronic
953926954 3:46987470-46987492 CTAAGCCCCTCCCAGGGGCCAGG - Intronic
953938013 3:47063358-47063380 CTCAGCCTCTTGCAAGTAGCTGG - Intronic
955005767 3:54966946-54966968 CTCAGCATCTTGCTGGAGGCAGG + Intronic
955764022 3:62320802-62320824 CTAAACCTCTTACACAGGGCTGG + Intronic
955997070 3:64688207-64688229 CTCCGCCTCTTGCAGCCGGCAGG - Intergenic
958467254 3:94473173-94473195 CTATGCCACTTGCAGGTGACAGG - Intergenic
962292619 3:134149223-134149245 CTCAGCTTCTGGGAGGGGGCAGG - Intronic
963492544 3:146019141-146019163 CTCAGCCTGGTGCAGGGAGCTGG - Intergenic
967881679 3:194306100-194306122 CCAAGCATCTTGAAGGGTGCCGG - Intergenic
972838892 4:42908092-42908114 CTAAAGCTCTAGCAGGTGGCAGG + Intronic
977276539 4:94984078-94984100 CTAAGCCAATTGGAGGGGGAGGG + Intronic
979919400 4:126479037-126479059 CTATGCCACTTGCAGGGAACAGG + Intergenic
982097829 4:151939059-151939081 CTAAGCCTCTTTCATTTGGCAGG - Intergenic
984507269 4:180635417-180635439 CTCTGCCTTTTGCAGGAGGCAGG + Intergenic
985932556 5:3070071-3070093 CTAAGCCTCCTGCTGGAGGAAGG + Intergenic
986456637 5:7927018-7927040 CAAAGTCTCTTCCAGGTGGCGGG + Intergenic
986464947 5:8011789-8011811 CTAGGCTTCTTGCAGGAGGGAGG - Intergenic
986709523 5:10478464-10478486 CTAAGGCTCTGGCTGGGGGTGGG + Intergenic
994164093 5:96590490-96590512 CAAGGCCACTTGCAGGTGGCAGG - Intronic
994728311 5:103462407-103462429 CTAAGATTCTTGCAAGAGGCTGG - Intergenic
1002295689 5:178229902-178229924 CTCACCCTCTTCCCGGGGGCTGG + Intronic
1003172734 6:3733002-3733024 CTCAGCCTCCTGCAGGGGACTGG - Intronic
1005567563 6:27112361-27112383 CTAAGCCTCTTCCATGGAGATGG + Intergenic
1005726611 6:28655378-28655400 CTGAGTCTCCTGCAGGAGGCTGG + Intergenic
1006793308 6:36717362-36717384 CTGGGCCTCCTGCAGGCGGCTGG - Exonic
1007722083 6:43890996-43891018 CTGAGCCTCTAGTCGGGGGCGGG - Intergenic
1009465749 6:63966833-63966855 ATAAACCCCTTGCAGGGGGAAGG - Intronic
1010921436 6:81686570-81686592 CTAAGTCCCATGGAGGGGGCAGG + Intronic
1011638820 6:89400710-89400732 CTCAGCCTCCTGCAGAAGGCTGG + Intronic
1011993573 6:93555603-93555625 TTAAGCCTCTTGGAGGTGGATGG + Intergenic
1012263142 6:97111243-97111265 CTATGCCTCTTGCAGGGGACAGG - Intronic
1014909253 6:127070128-127070150 CCAAGTCTCTTGAAGGTGGCAGG - Intergenic
1017591012 6:155978001-155978023 CTCACCCTCTTTCTGGGGGCAGG + Intergenic
1023609397 7:41958001-41958023 CCAAGCCTCTTGCATGGAGGAGG + Intergenic
1025974238 7:66356912-66356934 CTCGGGCTCTTGCAGGGGGCTGG + Intronic
1029248436 7:99219121-99219143 ATCAGCCTCTTGCCCGGGGCGGG - Intergenic
1030701531 7:112646733-112646755 CTAAGCCCCTGGTCGGGGGCAGG - Intergenic
1034680447 7:152924443-152924465 CTCAGCATCTTGCAGGTGCCAGG + Intergenic
1034699028 7:153080789-153080811 CTCAGCCTCCTGCAGGAGCCAGG - Intergenic
1039244171 8:35589998-35590020 CTAAGCCTCTTGCAAGAGGAAGG + Intronic
1039465591 8:37783217-37783239 CTAAGCCTCTGGCTGGTGGCCGG - Intergenic
1040337765 8:46424748-46424770 CTAAGCCGCTTCCAGGCGGGCGG + Intergenic
1041683196 8:60614501-60614523 CTACGCCTCTTTCAGAGTGCTGG + Intronic
1042812341 8:72840063-72840085 CTGAGCCTGTTGCAGGGTGGGGG - Intronic
1044474656 8:92612175-92612197 CTCTGCCTCCTGCAGGGGCCAGG - Intergenic
1046581118 8:116093565-116093587 ATAAGGCTTTTGCTGGGGGCAGG - Intergenic
1049280154 8:141740089-141740111 CTCATCCTCTTGGTGGGGGCTGG + Intergenic
1049642900 8:143723394-143723416 CTGAGTCTCTTGCAGGTGCCTGG - Intergenic
1050279489 9:4035532-4035554 CTAGGCCACTGGCAGGGGGAAGG - Intronic
1052823339 9:33156845-33156867 CTAAACCTATAGCATGGGGCAGG - Intronic
1055635372 9:78272320-78272342 CTAAACATCTTTCATGGGGCTGG - Intronic
1059502407 9:114766505-114766527 CTAAGACTCTGACAGGGGACAGG + Intergenic
1060191283 9:121594698-121594720 CCAGGCCTCTTGCAGGTGGTGGG + Intronic
1061385703 9:130288217-130288239 CTAAGCCTCTTCCTTGAGGCTGG + Intronic
1062219865 9:135409413-135409435 CTGGGCCTCATGCAGGGAGCAGG - Intergenic
1186539082 X:10381953-10381975 GGAAGCCTCTTGCATGGAGCAGG + Intergenic
1186728567 X:12383414-12383436 CTAAACCTCCTGCAGTGCGCAGG + Intronic
1190817694 X:53942994-53943016 CTAAGCTTCTGGTAGGGGCCAGG - Intronic
1195722351 X:107878765-107878787 CTATGCCACTTGCAGGGGGCAGG - Intronic
1196550513 X:117018214-117018236 CTAAGCCTCTTGCAGAGATGTGG - Intergenic
1198310894 X:135425203-135425225 CCAAGCCCCTTGCATGGGGAGGG - Intergenic