ID: 924010591

View in Genome Browser
Species Human (GRCh38)
Location 1:239660939-239660961
Sequence AATAATGCACACATAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924010591 Original CRISPR AATAATGCACACATAGAGCT TGG (reversed) Intronic
901646520 1:10719777-10719799 AAAACTGCACACAAAGAGCATGG + Intronic
903088275 1:20883664-20883686 AATAAAGGACAGAAAGAGCTAGG + Intronic
903894522 1:26595171-26595193 ATTACTGCAAACATACAGCTGGG + Intergenic
905589459 1:39149959-39149981 AATAATGCATACATACAAATAGG - Intronic
907684948 1:56601293-56601315 AATAATCCACTCTTAGAGCTAGG + Intronic
912639549 1:111332300-111332322 AATGAAGCAGTCATAGAGCTGGG - Intergenic
912981635 1:114379326-114379348 AGAAATGCAAATATAGAGCTGGG + Intergenic
913330000 1:117659316-117659338 AAGACTGCACACATAGGTCTAGG - Intergenic
915710956 1:157897360-157897382 AAAGAGGCAAACATAGAGCTTGG - Intronic
917708384 1:177657917-177657939 AATACTGAACACATAGAACAAGG + Intergenic
919487725 1:198164432-198164454 AATAATGCCTGTATAGAGCTAGG - Intronic
920937324 1:210447744-210447766 AATTATGCACTCAGAGAGCTTGG - Intronic
921521623 1:216162772-216162794 AAGGATGCACACATGGAGTTTGG - Intronic
922439291 1:225639293-225639315 AATCATGTATACATATAGCTTGG - Intronic
923646252 1:235823310-235823332 AATCATGCATAGATAGAACTAGG + Intronic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
924597446 1:245459760-245459782 AATAGTGCAGACCTGGAGCTAGG + Intronic
1063070849 10:2662340-2662362 AATAATGCCAAAATAAAGCTGGG + Intergenic
1063676344 10:8143583-8143605 AAAAATGCAGACCTAGACCTGGG - Intergenic
1063856136 10:10256226-10256248 TAAAATGCACACATAAAGCATGG - Intergenic
1064361001 10:14664166-14664188 AAACATGAACACAGAGAGCTAGG - Intronic
1064387263 10:14907517-14907539 ACTAATGCACAATTACAGCTAGG - Intronic
1066219944 10:33326530-33326552 AATCATGCATATATATAGCTGGG + Intronic
1068052090 10:51962826-51962848 ATTAATATAAACATAGAGCTAGG - Intronic
1068364600 10:56029895-56029917 AATACTCATCACATAGAGCTGGG - Intergenic
1068437389 10:57010168-57010190 AATAATACTAACATAGAACTTGG - Intergenic
1071859091 10:89654568-89654590 ACTAATACATACATAGAGCAAGG - Intergenic
1072752141 10:97988796-97988818 AATAATGCACACAAAATGCTTGG - Intronic
1076257341 10:129038158-129038180 AATAATGTACACAAGGAGCTTGG + Intergenic
1079677381 11:23247020-23247042 AATCATGCACTAATATAGCTTGG - Intergenic
1079717291 11:23764356-23764378 AAGAATGCAGACATAGAGCATGG + Intergenic
1080617624 11:33958818-33958840 AAAAATGAAGACACAGAGCTGGG + Intergenic
1082905294 11:58301252-58301274 AAGAATGCAGACACAGAGCCTGG - Intergenic
1082934268 11:58640102-58640124 AAGAATGCAAACATAGAGATTGG - Intergenic
1083383290 11:62286574-62286596 AATTATGCACTCAGGGAGCTTGG - Intergenic
1084083598 11:66844493-66844515 TAAAATGGAAACATAGAGCTAGG + Intronic
1086269850 11:85049388-85049410 CATATTGCAGACATAGTGCTAGG - Intronic
1087419907 11:97908855-97908877 AATAATTCACACAGATAGTTTGG - Intergenic
1087741519 11:101892772-101892794 AATGAAACAAACATAGAGCTTGG - Intronic
1087967044 11:104428611-104428633 AAAAATGCACACACAGGGCCGGG - Intergenic
1088531389 11:110813809-110813831 AATAATGCTCCTATAAAGCTGGG + Intergenic
1090876604 11:130794488-130794510 CCTAGGGCACACATAGAGCTGGG + Intergenic
1091414989 12:274940-274962 ATTAATGGCCACCTAGAGCTGGG + Intergenic
1091934006 12:4420784-4420806 AATAATACACGCAAAGTGCTTGG - Intergenic
1092681590 12:10988604-10988626 TATAATGCACACTTAGAAATGGG + Intronic
1092682418 12:10999527-10999549 TATAATGCACACTTAGAAATGGG + Intronic
1094445736 12:30527722-30527744 AATGATACAAACATACAGCTAGG + Intergenic
1095333128 12:40992442-40992464 AATAATGCACAGATCTACCTTGG + Intronic
1095706800 12:45245712-45245734 AATAATGCACTTAAAGGGCTTGG + Intronic
1096339574 12:50786288-50786310 AATAATAAACTCATAGAGGTGGG + Intronic
1099794876 12:87387356-87387378 AAAAATTGACAAATAGAGCTAGG + Intergenic
1100710395 12:97250123-97250145 AATTATGCTCACAAAGGGCTTGG + Intergenic
1102715365 12:114966967-114966989 AATAATGCACACATGGCCTTTGG + Intergenic
1102819240 12:115893987-115894009 AATTACGCACACTGAGAGCTGGG - Intergenic
1103215902 12:119201206-119201228 AATAAGGCAGTCAAAGAGCTGGG - Intronic
1103497810 12:121376307-121376329 AAAAATGCAAACATTTAGCTAGG - Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG + Intergenic
1108760616 13:53559175-53559197 AATAATGTATACAAATAGCTTGG + Intergenic
1110564958 13:76948817-76948839 CATAATGGACACATAAAACTAGG - Intronic
1110754469 13:79155805-79155827 AATCAGGCACAAATACAGCTTGG - Intergenic
1113097863 13:106685087-106685109 TTTAAAGCATACATAGAGCTTGG - Intergenic
1113285760 13:108847277-108847299 AATAATGCATAAATAGAGCATGG - Intronic
1114810158 14:25889616-25889638 AATTATGCACACATAGACAAAGG + Intergenic
1115585895 14:34812763-34812785 AATATAGCACACATAAAGCAGGG + Intronic
1116403394 14:44537697-44537719 AGTAATGTACATAAAGAGCTTGG + Intergenic
1116520315 14:45838907-45838929 AAAAATGCTCACACAGAGCAGGG + Intergenic
1116688438 14:48073518-48073540 AAGAATGCAGACACAGAGCATGG - Intergenic
1116726510 14:48566972-48566994 CAAAATGCACACATAAAGCAAGG + Intergenic
1118102257 14:62619921-62619943 AATAATGCCCTGATACAGCTTGG - Intergenic
1118702433 14:68446919-68446941 AATAATACACATATTAAGCTGGG + Intronic
1119613253 14:76081561-76081583 AATCATGCAAACAGAGAACTGGG - Intronic
1119696203 14:76715199-76715221 AAAAATGCACACATCTGGCTGGG - Intergenic
1120020933 14:79529135-79529157 AATTGTGCACTCAGAGAGCTCGG - Intronic
1121163927 14:91773656-91773678 ATGAATGAACACATAGAGTTAGG - Intronic
1121686653 14:95840390-95840412 AATAATGCACACGCCGAGCCAGG + Intergenic
1123179134 14:106451536-106451558 AATAATACAAAATTAGAGCTAGG - Intergenic
1126238672 15:46415970-46415992 AATCATGCACACAGATTGCTAGG - Intergenic
1126866954 15:52947279-52947301 AATTAAGCACACAAATAGCTTGG - Intergenic
1128271139 15:66311077-66311099 AAGAATGTACACATACTGCTGGG + Intronic
1128330502 15:66752488-66752510 AAAAATACATACATAGGGCTGGG + Intronic
1130165407 15:81452132-81452154 AACAATGCACACAAAGATGTAGG - Intergenic
1130917303 15:88315425-88315447 AATCATCCAGCCATAGAGCTTGG + Intergenic
1133687560 16:8180447-8180469 AATAATGAATACATAGAGAAGGG + Intergenic
1135451633 16:22563069-22563091 AATGGTGCACCCCTAGAGCTGGG + Intergenic
1140775810 16:78248058-78248080 ACTAATACACACATAGAGGATGG - Intronic
1141165526 16:81658193-81658215 ATTAATCCACAAATAGAACTTGG + Intronic
1144637675 17:16920669-16920691 AACAATGCACACCTAGGGCCTGG - Intergenic
1146357260 17:32144550-32144572 AATAATGCTCCCACACAGCTGGG + Intronic
1147221674 17:38936856-38936878 AAAAATGCATACATACAGGTTGG + Exonic
1147619645 17:41857033-41857055 TAAAAAGCACATATAGAGCTGGG + Intronic
1148575510 17:48707949-48707971 GATTCTGCACACACAGAGCTGGG + Intergenic
1148630955 17:49108600-49108622 AATAATGCTCTCCTAGTGCTGGG - Intergenic
1148634627 17:49138957-49138979 GATAATGCACACAAAGCTCTTGG + Intronic
1149011568 17:51862460-51862482 TATAATGCACACCTTGAGGTGGG - Intronic
1150372390 17:64651276-64651298 AAAAATATACACATAAAGCTGGG + Intronic
1150570806 17:66385401-66385423 AATCATCCACACATAGATGTGGG + Intronic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1155011837 18:21786390-21786412 AATAATAACCAAATAGAGCTGGG - Intronic
1156010874 18:32496332-32496354 AATAAAGCAAACATAGAGTGGGG - Intergenic
1158229961 18:55243377-55243399 AATAATACACACATACAGTGAGG - Intronic
1158529217 18:58243044-58243066 AATAATCGACACATGCAGCTGGG - Intronic
1159003735 18:62994657-62994679 AATAATGCACACAGAAAAGTTGG + Intergenic
1161621296 19:5298715-5298737 AAAAAGGCAGACATGGAGCTGGG - Intronic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1167931753 19:52871700-52871722 AATTGTGCACACATAGCTCTAGG + Intronic
1168492165 19:56820375-56820397 AATTATGCAGACATGGGGCTCGG + Intronic
927192210 2:20524520-20524542 CATCACGTACACATAGAGCTTGG - Intergenic
927718398 2:25367479-25367501 AACGATGCCCACACAGAGCTGGG + Intergenic
931905066 2:66833646-66833668 GATAATGCATACAAAGTGCTTGG + Intergenic
932011716 2:67984485-67984507 ACTAAAGCAAACAGAGAGCTGGG - Intergenic
932361477 2:71111538-71111560 AATAATCCACACACAGAGGTGGG - Intronic
932463486 2:71898266-71898288 AGTAATGGACAAAGAGAGCTGGG - Intergenic
932836533 2:75043285-75043307 GATAATGCACATACAGTGCTTGG + Intergenic
933306560 2:80607424-80607446 CATCAAGCACACACAGAGCTTGG - Intronic
934114240 2:88769103-88769125 AAGAATGCATACATACAGTTGGG - Intergenic
934635786 2:95988587-95988609 AAGAATGCATACATACAGTTGGG + Intronic
934797863 2:97116851-97116873 AAGAATGCATACATACAGTTGGG - Intronic
934835554 2:97586592-97586614 AAGAATGCATACATACAGTTGGG + Intronic
935866301 2:107391338-107391360 AAAAATGCACACATTAACCTAGG - Intergenic
938280120 2:130057854-130057876 AATGATGCACAGGTACAGCTTGG - Intergenic
938331077 2:130448569-130448591 AATGATGCACAGGTACAGCTTGG - Intergenic
938358871 2:130672934-130672956 AATGATGCACAGGTACAGCTTGG + Intergenic
938435264 2:131279587-131279609 AATGATGCACAGGTACAGCTTGG + Intronic
939395530 2:141624677-141624699 AATAATGCTAACATAAAGTTTGG - Intronic
939434211 2:142153006-142153028 AATAATGAAAAAATATAGCTGGG - Intergenic
939814916 2:146882219-146882241 AATAATGCAGACATAGCCTTGGG - Intergenic
941441953 2:165549426-165549448 AATTAGGCAGATATAGAGCTTGG + Intronic
941857148 2:170242724-170242746 AAGAAGGCACAGATAGCGCTGGG - Intronic
942257557 2:174119677-174119699 ACTAATGAACACATAAAGATGGG + Intronic
942261436 2:174168617-174168639 AATTATGCACACAATGAACTGGG + Intronic
943949021 2:194105631-194105653 AATAATACTAACCTAGAGCTGGG + Intergenic
944131402 2:196351268-196351290 AATATTCCACACACAGAGATGGG + Intronic
944541999 2:200763030-200763052 AATAAGGCAAACATATACCTGGG - Intergenic
944564116 2:200970297-200970319 AAAAATGTACACAGAGGGCTGGG + Intergenic
944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG + Intergenic
1169060970 20:2660114-2660136 AATAATGTTCCCATAGAGATTGG + Exonic
1171353686 20:24525720-24525742 AAAAATGCACATATAAAACTTGG - Intronic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1172492667 20:35352973-35352995 AAAAATTAAGACATAGAGCTGGG - Intronic
1173380990 20:42541098-42541120 AACTATGCGCACATAGAACTTGG + Intronic
1175292868 20:57889941-57889963 AATAAACCACACATAGATCAGGG - Intergenic
1175765004 20:61586362-61586384 GTTAATGCACATAAAGAGCTTGG - Intronic
1177590414 21:23157662-23157684 AGGAAGTCACACATAGAGCTGGG + Intergenic
1180858306 22:19062166-19062188 AACAATGCACTCATAAAGCCAGG + Intronic
1182028149 22:27136471-27136493 AATAATGCACAAAAATAGCCTGG + Intergenic
1184608717 22:45589257-45589279 AAGAATGCACACATCATGCTGGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949498575 3:4656584-4656606 AAAAAAACACACATAGAGGTTGG + Intronic
953297544 3:41735463-41735485 ACTGATGGGCACATAGAGCTCGG - Intronic
953918358 3:46935091-46935113 GGTCATGCACACATTGAGCTGGG + Intronic
954922661 3:54205057-54205079 AATAATGAAGACATGGAGTTAGG + Intronic
955923232 3:63980413-63980435 CATAGTACACACATAGAGTTAGG - Intronic
955986692 3:64581090-64581112 AATAATGCACACAAAGGACCTGG + Intronic
956990188 3:74753163-74753185 AATAATACACATATTGAACTTGG + Intergenic
957282542 3:78172095-78172117 CATATAGCACACATAAAGCTGGG + Intergenic
957999452 3:87733772-87733794 AATTGTGCACTCAGAGAGCTCGG - Intergenic
960113896 3:113873499-113873521 AATAAAAAACACATAGTGCTAGG - Intronic
960408784 3:117295140-117295162 AACAAAGCACAATTAGAGCTCGG + Intergenic
962343643 3:134604759-134604781 CAGGATGCACACATACAGCTTGG - Intronic
963713432 3:148774695-148774717 AAAAATGCCCCCATAGATCTAGG + Intergenic
963974605 3:151466872-151466894 AAAAATGCACACGTTGAGCCAGG - Intergenic
963993741 3:151683073-151683095 AAAAATGAACACATAGACCATGG + Intergenic
965439532 3:168695928-168695950 AATAATGCTCACATAAGGATAGG + Intergenic
970036636 4:11742981-11743003 ACTAATGCTTACATAGTGCTTGG + Intergenic
971079102 4:23187487-23187509 AATAATAGACACATAGATCAAGG - Intergenic
975148119 4:70992717-70992739 AAAAATGCACTCATCTAGCTGGG + Intronic
977556609 4:98493253-98493275 AGAAGTGCACACACAGAGCTTGG + Intronic
977784952 4:101022173-101022195 AAAAATGCATACATAGAAATGGG - Intergenic
978005594 4:103612288-103612310 AATAAAGCACACAAAGAATTAGG - Intronic
979066317 4:116139081-116139103 AATATTGCACACTTATAACTAGG + Intergenic
979523309 4:121692780-121692802 AATAATGCACACAAAAGACTTGG + Intronic
980140616 4:128912000-128912022 AATAATGCACACAGAGAAGCAGG + Intronic
980810466 4:137871569-137871591 AATAATGCTAACTTAGAACTAGG - Intergenic
980816904 4:137959531-137959553 AATAAAGCAGACATAGATTTAGG + Intergenic
981567112 4:146113457-146113479 ACAAACGCACACATAGAGGTAGG - Intergenic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
983351272 4:166593323-166593345 TATAATGTGCACATAGAGATGGG + Intergenic
983783090 4:171697620-171697642 AATATTGAACACATGGAGATAGG - Intergenic
984336632 4:178400698-178400720 AATACTACATACAAAGAGCTTGG - Intergenic
986884524 5:12216817-12216839 AATAATACAAACATTTAGCTGGG + Intergenic
988120960 5:26961793-26961815 GATAATGCACTCATGGTGCTAGG - Intronic
988121145 5:26964602-26964624 GATAATGCACTCATAGTGCTAGG - Intronic
988720707 5:33876086-33876108 AACAAAACACATATAGAGCTAGG + Intronic
990129343 5:52561255-52561277 AATAAAGCACATTAAGAGCTAGG - Intergenic
990755223 5:59061498-59061520 GACAATGTACACATAGAGGTGGG - Intronic
991685480 5:69178436-69178458 TATAATGCACAAATACAGGTAGG - Intergenic
994165175 5:96600636-96600658 AAACAGGGACACATAGAGCTGGG - Intronic
994267402 5:97734647-97734669 AATAATGCTTTGATAGAGCTAGG - Intergenic
994594185 5:101809562-101809584 AATAATGGAAACGTACAGCTAGG + Intergenic
996591700 5:125155291-125155313 ACTAATACACACACAGAGCTAGG - Intergenic
998139151 5:139690164-139690186 AATAATGCACACATATTTATAGG - Intergenic
998816557 5:146020384-146020406 AATAATGCAGGCATTGTGCTGGG - Intronic
998983524 5:147730049-147730071 AATAATGTAAGCAAAGAGCTTGG + Intronic
999221507 5:149982832-149982854 AATAATACACCCATAGCACTTGG - Exonic
999694030 5:154172560-154172582 AATGATGTACACAAAGAGATTGG + Intronic
1000138198 5:158374620-158374642 GATACTGCACACATAGCACTAGG + Intergenic
1000456851 5:161460103-161460125 AAAAATACAAACAAAGAGCTGGG - Intronic
1001918086 5:175578352-175578374 AAAAAAGCACACATAGACATTGG + Intergenic
1004177595 6:13353697-13353719 AAGAATGGACACAGAGAGATTGG + Intergenic
1004978738 6:20998288-20998310 CATACTGCACACTTGGAGCTGGG - Intronic
1005472769 6:26178181-26178203 AATTGTGCACTCAGAGAGCTCGG + Intergenic
1006321339 6:33321391-33321413 ATTGATGTAGACATAGAGCTTGG + Exonic
1006450746 6:34104413-34104435 AATAATCCACACGAAGTGCTTGG - Intronic
1007070120 6:39030253-39030275 AATAGGACACACATACAGCTTGG - Exonic
1009346084 6:62614236-62614258 AATGGAGCAAACATAGAGCTAGG + Intergenic
1011542079 6:88441591-88441613 TGTGATGCTCACATAGAGCTGGG - Intergenic
1013816060 6:114099698-114099720 AATAATCCACATATATTGCTAGG + Intronic
1013990071 6:116243365-116243387 AATTAAACTCACATAGAGCTCGG + Intronic
1014341171 6:120209120-120209142 AATATTCCAGACATAGACCTTGG + Intergenic
1014341407 6:120212156-120212178 AGTAACGCACACTTCGAGCTTGG + Intergenic
1014661100 6:124172871-124172893 AATAGTTCACATATAGAGTTTGG + Intronic
1016897363 6:149066521-149066543 ATTAATGCAAAACTAGAGCTTGG + Intronic
1018264252 6:162004672-162004694 ACTAATGAACTCATAGAACTGGG + Intronic
1018657611 6:166054579-166054601 GATAATGCAAACATAAAGCCAGG - Intergenic
1019803791 7:3107735-3107757 AAGAATGCACACAGACAACTTGG - Intergenic
1020555066 7:9660793-9660815 AATAGTGCAGACCTAGAGCAAGG - Intergenic
1021242413 7:18220023-18220045 TATAATGTACACATAGTGCCTGG + Intronic
1021375337 7:19900154-19900176 AATAAAAAACACATAGACCTTGG + Intergenic
1021437391 7:20635251-20635273 AATAATAGACACATAGATCAAGG - Intronic
1022014971 7:26341778-26341800 AATAATGCACATAGAGGGCTGGG - Intronic
1023405075 7:39825169-39825191 AACATTGCACATATAGGGCTTGG - Intergenic
1026423401 7:70264499-70264521 AATAATGCAAACATTTGGCTGGG - Intronic
1027392573 7:77720057-77720079 AAAAAAGGACACATACAGCTGGG - Intronic
1028316567 7:89409559-89409581 AATTATTCACACCTTGAGCTGGG - Intergenic
1028352462 7:89865691-89865713 AAAACTGTACACATAGAGTTTGG + Intergenic
1030380990 7:108811845-108811867 AAGAATACCCACATAGGGCTGGG + Intergenic
1035995255 8:4539699-4539721 AATAATTCAAGGATAGAGCTAGG - Intronic
1037349048 8:17929760-17929782 AATAACATACACATAGAGTTTGG - Intronic
1038048406 8:23786773-23786795 AATCATGCTCACATCTAGCTTGG - Intergenic
1038510589 8:28130781-28130803 AATAATGAACTCCTAGAGATGGG + Intronic
1038667620 8:29553706-29553728 AAGAATGCACACGTGTAGCTTGG + Intergenic
1039440607 8:37592713-37592735 ACTTATGGACACATAGATCTGGG + Intergenic
1039896026 8:41717099-41717121 AAAACGGCACACACAGAGCTAGG + Intronic
1040810075 8:51441904-51441926 AATAATACACACATGAAGCCTGG + Intronic
1041168170 8:55112327-55112349 AATCATGCACATATAGAAGTAGG + Intronic
1041542534 8:59002295-59002317 AAAAATGCAGACATAGGGCCGGG + Intronic
1042208008 8:66348385-66348407 ATTAATCCAGACATAGACCTAGG + Intergenic
1042643873 8:70964314-70964336 AAAAATGGACACATAGACCAAGG - Intergenic
1046399561 8:113687049-113687071 AATGATGCTTACATGGAGCTTGG + Intergenic
1047827287 8:128590902-128590924 GATAATGCACATAAAGTGCTTGG + Intergenic
1048660161 8:136590655-136590677 TATAATGCACACATAGGGAAGGG - Intergenic
1051949939 9:22619390-22619412 AAGAATGCAGACATAGGGCTAGG + Intergenic
1053261605 9:36670959-36670981 AACAAGGCACAAGTAGAGCTGGG - Intronic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1055227025 9:74010888-74010910 AATAATAAACACTAAGAGCTCGG - Intergenic
1056279493 9:85027362-85027384 AAAAATACATACATATAGCTGGG - Intergenic
1060080593 9:120640591-120640613 AAGAAAGCACACATAGACTTTGG - Intronic
1185510909 X:664607-664629 AATAATCCTCCCAAAGAGCTGGG + Intergenic
1186219422 X:7333815-7333837 GATAATGCACGGACAGAGCTGGG + Intronic
1188032021 X:25274631-25274653 ATTAAGGTACACATACAGCTTGG - Intergenic
1188058500 X:25570520-25570542 AATTATACACAAATAAAGCTGGG - Intergenic
1189211408 X:39287093-39287115 AAAAATGCACACATGTAACTTGG - Intergenic
1189586343 X:42466114-42466136 AATAAAGCACTTAAAGAGCTGGG + Intergenic
1189837314 X:45039092-45039114 AATAATTCTGCCATAGAGCTGGG - Intronic
1191943118 X:66501082-66501104 AAGAATGCCCATATGGAGCTTGG + Intergenic
1193193393 X:78600732-78600754 AAAAATGGACACATAGACCAAGG + Intergenic
1197751369 X:129966041-129966063 AATAAAGTACACAGTGAGCTTGG + Intergenic
1198380893 X:136082386-136082408 AATTATGCAAAAATAGAGATGGG + Intergenic
1198435183 X:136610062-136610084 TATAATACAGACATGGAGCTCGG - Intergenic
1199752570 X:150834721-150834743 ATTAATACACACACAGAACTGGG - Intronic
1201593228 Y:15637868-15637890 AAGCATGCACACACACAGCTGGG + Intergenic
1202584950 Y:26412841-26412863 AAGAATGCATACATACAGTTGGG - Intergenic