ID: 924012261

View in Genome Browser
Species Human (GRCh38)
Location 1:239677976-239677998
Sequence CTGTGGATCGCGCCCTCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924012261 Original CRISPR CTGTGGATCGCGCCCTCAGC GGG Intronic
911171218 1:94772902-94772924 GTGTGGATTGAGCCCTGAGCTGG + Intergenic
914352423 1:146852079-146852101 CTGTGCAGCGAGCTCTCAGCAGG - Intergenic
917974799 1:180231603-180231625 CTGTGGCTTGCACGCTCAGCAGG + Intronic
918142599 1:181732074-181732096 CTGTGGATGGCTGCCCCAGCAGG + Intronic
924012261 1:239677976-239677998 CTGTGGATCGCGCCCTCAGCGGG + Intronic
1066711005 10:38233753-38233775 GTGTGGGTCTGGCCCTCAGCAGG + Intergenic
1068363443 10:56012086-56012108 CTTTGGAGAGCTCCCTCAGCTGG - Intergenic
1070948550 10:80412794-80412816 CTGTGGAGGGCCCCATCAGCTGG + Intronic
1073096084 10:100980574-100980596 TTGTGGATCCAGCCATCAGCTGG - Exonic
1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG + Intronic
1076714110 10:132354635-132354657 CTCGGGATGGAGCCCTCAGCAGG + Intronic
1080802028 11:35618391-35618413 CTGTGAATCGCGCCCACCGGAGG + Intergenic
1082710304 11:56546969-56546991 CTGTGGGTGGAGCCCTCACCAGG - Intergenic
1083667434 11:64283567-64283589 CTGTGGCTCGTACCCACAGCAGG - Intronic
1084309697 11:68309763-68309785 CTGTGGCTGGAGCCCTGAGCAGG + Intergenic
1084415727 11:69032013-69032035 CTGTGGATAGAGCTCTAAGCAGG + Intergenic
1085096004 11:73761065-73761087 CAGAGGCTCGCGCACTCAGCAGG - Exonic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1103418802 12:120763351-120763373 CTGTGGATCGAGCTCACAGGGGG - Exonic
1104993307 12:132639080-132639102 CTGTCCACCGCGTCCTCAGCTGG - Intronic
1105378515 13:19864795-19864817 CTGTGGGGCCCGCCCTCACCGGG - Intergenic
1112439522 13:99415884-99415906 CTGTGGCTCCCTGCCTCAGCCGG + Intergenic
1117475057 14:56085660-56085682 CTCTGGATTGCTCCCTCTGCCGG + Intergenic
1121082006 14:91115742-91115764 CCGGGGATCTAGCCCTCAGCTGG - Intronic
1130607530 15:85331407-85331429 CTGTGTAGAGAGCCCTCAGCGGG - Intergenic
1132469972 16:97095-97117 CTGTGGGTGGCGCCCTCGTCTGG - Intronic
1133388886 16:5393088-5393110 CTGTGGCTCAGGGCCTCAGCAGG + Intergenic
1135153586 16:20032242-20032264 CTGTGCATCACGTCCTCATCTGG - Exonic
1135968486 16:27055059-27055081 CTGTGCTTCGTGCCCTCTGCTGG + Intergenic
1141281169 16:82630894-82630916 CTGTGGATGGAGCCCTCTTCTGG - Intronic
1152133373 17:78490574-78490596 CTGTGTATCAGGCCCTCACCAGG - Intronic
1155778196 18:29794579-29794601 CTGGGGATGGAGCCCTCACCAGG + Intergenic
1162782627 19:13014417-13014439 CTGGGAAACGCGCCCTCGGCTGG - Intronic
1165160672 19:33813826-33813848 CTGGGGATGGCTCCCTGAGCTGG - Exonic
925062508 2:904361-904383 CTGTCCTTCGCACCCTCAGCAGG + Intergenic
936278172 2:111118118-111118140 CTGTGGGGCGCGCTCGCAGCGGG - Exonic
938271847 2:129979653-129979675 CAGAGGCTCGCGCACTCAGCAGG + Exonic
938444154 2:131364147-131364169 CAGAGGCTCGCGCACTCAGCAGG - Intergenic
943743765 2:191439627-191439649 CTGTGTAATGGGCCCTCAGCTGG - Intergenic
943868359 2:192958714-192958736 CTGTGGAACGGGACCTCAGTGGG + Intergenic
948548100 2:238746683-238746705 GTGTGGATGGAGCCCTCACCTGG - Intergenic
1175975339 20:62708042-62708064 CTGTGGCTCCCGGCCTCTGCAGG + Intergenic
1176198033 20:63846571-63846593 CTGGGGAACCCGCCCTCCGCTGG + Intergenic
1178977636 21:37233143-37233165 CTCTGGCCCGCGGCCTCAGCTGG + Intronic
1179250923 21:39670540-39670562 CTGTGGACCACGCCTGCAGCTGG - Exonic
1180593797 22:16961089-16961111 CTGGGGATCCATCCCTCAGCAGG - Intergenic
1180707573 22:17818701-17818723 CTGTGGATGAGGCCCTCAGACGG - Exonic
1180708449 22:17823873-17823895 CTGTGGACAACCCCCTCAGCTGG - Intronic
1180722242 22:17917969-17917991 CTGTGGATGGGCACCTCAGCAGG - Intronic
955093603 3:55775407-55775429 CTGTGGTTCGAGCTCTCAGGAGG + Intronic
955317239 3:57949040-57949062 ATGTGGATCGCAACTTCAGCAGG - Intergenic
961553480 3:127681939-127681961 CTGTGGACCGCCCCCCCACCAGG + Intergenic
966936237 3:184711654-184711676 CTGCGGAGCCCGCCCTCACCCGG - Exonic
967124871 3:186414295-186414317 ATGTGAATCGCTGCCTCAGCAGG + Intergenic
970273208 4:14368830-14368852 CTGAGGATAGAGCCCTCACCAGG + Intergenic
973058437 4:45689247-45689269 CTGTGCATAGAGCCCTGAGCAGG - Intergenic
980043247 4:127963762-127963784 CTGTGGAAAGGGACCTCAGCGGG + Intronic
985802039 5:2010825-2010847 CTGTGGGGCTCGCCATCAGCGGG - Intergenic
986444000 5:7805561-7805583 CTGTGGAGCCTGCCCTCTGCTGG + Intronic
992399856 5:76402626-76402648 CTGTGGCTTGCGACCCCAGCTGG + Intergenic
1018889049 6:167968285-167968307 CTGAGGATGGCGCCCTCTGCAGG + Intronic
1019334046 7:474592-474614 AAGTGGATCGTGCCCTTAGCTGG + Intergenic
1019488854 7:1301740-1301762 CTGGGGATCGAGTGCTCAGCAGG + Intergenic
1019524563 7:1474911-1474933 CGGTGGATCACGGCCACAGCTGG - Intronic
1023545698 7:41315953-41315975 CTCTGCACAGCGCCCTCAGCTGG - Intergenic
1025782818 7:64616980-64617002 ATGTGGATCTGGCCCACAGCTGG + Intergenic
1027800166 7:82740435-82740457 TTGTGAATCACGCCCTCTGCTGG - Intergenic
1035238895 7:157517445-157517467 CTTTGGGTCGTGCCCTCTGCGGG + Intergenic
1193846603 X:86479354-86479376 CTGAGGATGGAGCCCTCAACAGG + Intronic
1201763765 Y:17562243-17562265 GTGTGCATCTCGCCCTCAGGAGG - Intergenic
1201837788 Y:18343747-18343769 GTGTGCATCTCGCCCTCAGGAGG + Intergenic