ID: 924015150

View in Genome Browser
Species Human (GRCh38)
Location 1:239713066-239713088
Sequence TTGCAGAAGCAGATTGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924015150_924015151 1 Left 924015150 1:239713066-239713088 CCGGGCACAATCTGCTTCTGCAA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 924015151 1:239713090-239713112 GACTGTGTCAACGTACTTCATGG 0: 1
1: 0
2: 0
3: 1
4: 49
924015150_924015152 2 Left 924015150 1:239713066-239713088 CCGGGCACAATCTGCTTCTGCAA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 924015152 1:239713091-239713113 ACTGTGTCAACGTACTTCATGGG 0: 1
1: 0
2: 0
3: 1
4: 45
924015150_924015153 15 Left 924015150 1:239713066-239713088 CCGGGCACAATCTGCTTCTGCAA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 924015153 1:239713104-239713126 ACTTCATGGGCATTTCTGTGCGG 0: 1
1: 1
2: 1
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924015150 Original CRISPR TTGCAGAAGCAGATTGTGCC CGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900698005 1:4024304-4024326 TTGAAGAAGCTGATTGTCTCTGG + Intergenic
901061136 1:6472428-6472450 TTGCAGAAGGAGCAGGTGCCTGG - Intronic
904048246 1:27622310-27622332 AGGCAGAGGCAGATTCTGCCAGG - Intronic
905249619 1:36639470-36639492 TTACAGGAGCAGCTTGTTCCAGG - Intergenic
905434311 1:37946432-37946454 TTGCAGAGGGAGATGGTACCGGG + Intronic
910477983 1:87627593-87627615 TTGCAGCAGCAGATTGTAACAGG + Intergenic
913046087 1:115074526-115074548 TTTCAGAAGCTGATTGATCCCGG - Intronic
913573479 1:120144699-120144721 TTCCAGAAGCAAATTTAGCCAGG + Intergenic
914294738 1:146309500-146309522 TTCCAGAAGCAAATTTAGCCAGG + Intergenic
914555779 1:148760283-148760305 TTCCAGAAGCAAATTTAGCCAGG + Intergenic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
922024068 1:221734301-221734323 TTGCAAAAACATATTGGGCCAGG - Intronic
924015150 1:239713066-239713088 TTGCAGAAGCAGATTGTGCCCGG - Intronic
1065229288 10:23580350-23580372 TTGCTGTAGCAGAGTGTGCTGGG + Intergenic
1065385117 10:25126383-25126405 TTGTAAAAGCAGATTGAGGCTGG - Intergenic
1066378855 10:34884380-34884402 TGGCAGGGGCAGGTTGTGCCGGG - Intergenic
1072000350 10:91189186-91189208 TTGTAAAAGAAGATTTTGCCAGG - Intronic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1073042977 10:100619907-100619929 TTCCAGAAGGAGATTGTCACAGG - Intergenic
1079147295 11:17864779-17864801 ATTCAGAAGGAGATGGTGCCTGG - Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1084113402 11:67027814-67027836 TTGCAAAGTCAGCTTGTGCCAGG + Intronic
1085635826 11:78158899-78158921 TTGGAGAAGCAGGTGGGGCCAGG - Intergenic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1086069973 11:82789355-82789377 TTGCAGAATGATAGTGTGCCAGG - Intergenic
1086086154 11:82956956-82956978 TTGCAGTTCCAGATTGTACCTGG + Intronic
1092557842 12:9576836-9576858 TTGCAAAGGCACAGTGTGCCGGG + Intergenic
1093744531 12:22724502-22724524 TTGCAGAAACACACTGTGCTAGG - Intergenic
1094083441 12:26563116-26563138 TGGCAGAAGCAGTTTTTACCTGG + Intronic
1094153494 12:27312580-27312602 TGGTAGAAGCAGATGGTGCCTGG + Exonic
1094513451 12:31111074-31111096 TTGCAAAGGCACAGTGTGCCGGG - Intergenic
1097326847 12:58286996-58287018 TTGCAGAAGCAAATTCTGCAGGG - Intergenic
1100600246 12:96106802-96106824 TTGCATATGCAGGTTGTGGCTGG + Intergenic
1100703704 12:97177650-97177672 ATGCTGACGCAGATTGTGGCAGG + Intergenic
1101138172 12:101767405-101767427 TTTCAGCAGCAGATTGTGATAGG - Intronic
1101327505 12:103728907-103728929 TTCCAGAAGCAGCTGGTGGCAGG - Exonic
1102505275 12:113380792-113380814 TCGCAGGAGAAGATGGTGCCGGG - Exonic
1103232029 12:119339487-119339509 TTAAAGGAGCAGATTCTGCCAGG + Intronic
1103338890 12:120210725-120210747 TGGCAGAAGCCGAGTGTGCTGGG - Exonic
1106602887 13:31202084-31202106 TTGCTGAAACAGAATGTGACAGG + Intronic
1108856832 13:54802988-54803010 TTGCAGTATCAGATAATGCCAGG - Intergenic
1113898919 13:113785045-113785067 TTGCAGGAGCAGAATGTTTCTGG + Intronic
1118276308 14:64388621-64388643 TTGCAAACGCAGGTTGTGCCCGG - Intronic
1118655823 14:67947278-67947300 TTAGAGAAGCAGATTATTCCGGG + Intronic
1121718005 14:96089876-96089898 TTGCAGAACAAGATGGTCCCAGG - Exonic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1127265223 15:57355497-57355519 TTGCTAAAGCAGTTTGTGTCAGG - Intergenic
1127998682 15:64171123-64171145 TGGCAGATGCATATTGTGTCTGG - Exonic
1130060108 15:80563584-80563606 TTGCAGCAGCTGCTTGTGCCTGG + Intronic
1130615622 15:85404356-85404378 TTGCAGAACCAAACTGTGGCAGG - Intronic
1131059729 15:89397328-89397350 TTGCATAAGCAGCATGTGTCTGG + Intergenic
1137290404 16:47048711-47048733 TTGCCAAAGCTGATTGGGCCAGG + Intergenic
1139021812 16:62759364-62759386 TTGAAGGAGCAGATTGTTTCTGG + Intergenic
1140825967 16:78706956-78706978 TTCCAAAGGCAGTTTGTGCCAGG - Intronic
1141174412 16:81709679-81709701 TTGCAGAAGCTGCCAGTGCCTGG - Intronic
1141319638 16:82995253-82995275 TTGCAACAGCAGATTTTGCTGGG + Intronic
1141441011 16:84029595-84029617 TTGCAGCCGCAGGTTGTTCCGGG - Intronic
1145261877 17:21359344-21359366 TGGCAGAAAGAGAGTGTGCCTGG + Intergenic
1148214291 17:45825968-45825990 TTGAATAAGCAATTTGTGCCCGG - Intronic
1148334842 17:46834308-46834330 CTGGAGAAGCAGGTGGTGCCTGG + Intronic
1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG + Intergenic
1151203996 17:72491558-72491580 TATTAGAAGCAGATTGTGGCTGG - Intergenic
1153254121 18:3153034-3153056 TGGCAGAAGCTGATAGGGCCAGG + Intronic
1153592288 18:6686329-6686351 TTGAACATGCACATTGTGCCAGG + Intergenic
1156164080 18:34396931-34396953 ATTCTGAAGCAGATAGTGCCTGG + Intergenic
1156460927 18:37320905-37320927 TTGCAGGAGGAGCTGGTGCCCGG + Intronic
1159012061 18:63066882-63066904 TTGCAGAAGAATCTTTTGCCAGG - Intergenic
1159637662 18:70825190-70825212 TTGTAAAAGCACATTGTGCCTGG - Intergenic
1160508784 18:79441909-79441931 TGGCTGAAGAAGATTCTGCCCGG - Intronic
1163305837 19:16478310-16478332 TTCCAGAAGAAGACTGGGCCAGG + Intergenic
1164043599 19:21514001-21514023 TTGCTGTTGCAGATTGTGTCTGG - Intronic
1164713684 19:30376558-30376580 TTTCAGAAACAGAATGGGCCAGG + Intronic
1165560242 19:36672757-36672779 TGGCAGAAGCATTTTGTGTCAGG - Intergenic
1166388880 19:42397765-42397787 TTGGAGGAGCAGAAGGTGCCAGG + Intergenic
1166523795 19:43498570-43498592 ATGCAGAAGTGGATTGTGTCTGG + Intronic
1167843356 19:52139914-52139936 TCCCGGAAGCAGATTGCGCCAGG - Exonic
925338961 2:3120630-3120652 TTGAATAAGCAGATTCTGCCAGG - Intergenic
925368474 2:3326929-3326951 TTTCAGAGGAAGATGGTGCCAGG + Intronic
926219209 2:10924045-10924067 GTGCAGAAGCAAAGAGTGCCCGG - Intergenic
936646216 2:114375872-114375894 TGGCAGAAGCATTTTGTGCAGGG + Intergenic
940411918 2:153374781-153374803 TTGCAGGATCAGGTTCTGCCAGG + Intergenic
943321556 2:186450410-186450432 TTGAAGAAGAAGATGGGGCCAGG + Intergenic
943447691 2:188009256-188009278 TTTCAGGAGCAGCTTCTGCCTGG - Intergenic
947726718 2:232406043-232406065 TTGCACAGGCAGAGGGTGCCTGG - Intergenic
948046027 2:234946042-234946064 TTGCACTTGCAGATTCTGCCTGG + Intergenic
1170099167 20:12679632-12679654 TAGCAGAATCAGAATGTGCGTGG + Intergenic
1170870605 20:20202674-20202696 TTGCAGTAGCAAACTGTGCAAGG + Intronic
1174175281 20:48640696-48640718 TCCCAGAACCAGCTTGTGCCAGG - Intronic
1176015341 20:62928131-62928153 TTGCAGAAACAAATTGTGGCTGG - Intronic
1176210431 20:63918219-63918241 TTTCAGAAGCAGATCAAGCCAGG + Intronic
1177163795 21:17577822-17577844 TAGGAGAAGCAGAGAGTGCCAGG - Intronic
1178497311 21:33098242-33098264 TTGCAGAAGCAAGTGGTCCCGGG - Intergenic
1178601751 21:34000514-34000536 GGCCAGCAGCAGATTGTGCCAGG + Intergenic
1181905641 22:26193441-26193463 TAGCAGAACCACATTGGGCCAGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1184281222 22:43438560-43438582 TTGTAGAACCAGAGTGTACCTGG + Intronic
949668977 3:6376324-6376346 TTGAAGAAGCAGAATTTTCCAGG + Intergenic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
959512466 3:107229582-107229604 TTGGAGAAGCAGTTCTTGCCTGG - Intergenic
961132646 3:124483209-124483231 TTACAGAAGCAGATTCCTCCTGG + Intronic
973624467 4:52757604-52757626 TTGCAGTAGAATAATGTGCCTGG + Intergenic
974093286 4:57334929-57334951 AGGCAGAAGGAGATTGTGCACGG + Intergenic
976144950 4:82033070-82033092 TTGCAGAAACAGATAGTGGCTGG - Intronic
977728102 4:100321016-100321038 TTGCAGAAGCACTATGTGCAGGG - Intergenic
979269843 4:118746719-118746741 TTGCAAAGGCACAGTGTGCCTGG + Intronic
980019904 4:127696324-127696346 TTGCAAAAGCAGAATGCACCAGG - Intronic
984983964 4:185309381-185309403 TTGCAGAGGCAGATTGTCAGAGG + Intronic
986459392 5:7954587-7954609 TTGCCAATGCAGAATGTGCCCGG - Intergenic
989112378 5:37919005-37919027 TTGGAGAAGCAGATAGTACTGGG - Intergenic
991491318 5:67185736-67185758 TAGTATAAGCAGATTGTCCCTGG + Intronic
991921671 5:71663459-71663481 TTGCAGAAGAACATGTTGCCAGG - Intergenic
992553651 5:77882991-77883013 CTGCAGAGGCAGATTCTGCAAGG - Intergenic
993756655 5:91739383-91739405 TTGTAGAAGTAGATTCTTCCTGG - Intergenic
997653862 5:135541275-135541297 TTGCAGATGCAGCTTATGACAGG + Intergenic
1000393874 5:160752340-160752362 TTACAGAAGCAGCTTGTGACAGG + Intronic
1000592726 5:163177935-163177957 TTGGAGAAGCAGTTTGTGGGAGG + Intergenic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1006856492 6:37137337-37137359 AAGCAGAAACTGATTGTGCCCGG + Intergenic
1006860130 6:37166319-37166341 TTGCATAAGCATATAGTCCCTGG + Intergenic
1007029514 6:38615467-38615489 TGGCTGGAGCAGAATGTGCCAGG - Intronic
1012298682 6:97556974-97556996 TTGCAAAAGCAATTTGTGGCAGG - Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1014470889 6:121813589-121813611 TTCCAGATGCAAAATGTGCCAGG + Intergenic
1016909384 6:149182450-149182472 TTGCAGAAGTTGTTTTTGCCTGG - Intergenic
1018931234 6:168241724-168241746 GTGCAAAAGCAGAAGGTGCCAGG + Intergenic
1020865151 7:13551029-13551051 TTGCAGTAGCAGATACTGCCAGG - Intergenic
1020917434 7:14213614-14213636 TTGCAGAAGCAGGTGTTACCTGG + Intronic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1022602519 7:31775359-31775381 TTGTAGAGGCAGATCGTGCAAGG - Intronic
1024880061 7:54074702-54074724 TTTCAAAAGTAGTTTGTGCCAGG - Intergenic
1033545709 7:142398244-142398266 TTACAGAAGTAGAATCTGCCTGG + Intergenic
1033548401 7:142423336-142423358 TTACAGAAGCAGAGTTTGCCTGG + Intergenic
1034497996 7:151433466-151433488 TTGAGGCAGCAGACTGTGCCAGG - Intronic
1034976747 7:155453645-155453667 TTGGGGAAGCAGAGTGGGCCAGG - Intergenic
1035535236 8:386092-386114 GCTCAGAAGCAGATTCTGCCTGG + Intergenic
1039053664 8:33516441-33516463 TTGCATGACCAAATTGTGCCAGG - Intergenic
1039441479 8:37598295-37598317 TTACAGAAGAAAACTGTGCCTGG - Intergenic
1039908653 8:41806767-41806789 TTGTAAGAGCAGATTGTGACAGG + Intronic
1043801317 8:84614149-84614171 TAGTTGAAGCATATTGTGCCTGG + Intronic
1044609574 8:94078660-94078682 TTGCAGTAGAAGCCTGTGCCTGG + Intergenic
1047425602 8:124742706-124742728 TTGAAGACAAAGATTGTGCCTGG - Intergenic
1050446987 9:5734672-5734694 TAGCAGAGGCAGTTTGTGACTGG - Intronic
1051493941 9:17697769-17697791 TTGCAGAAGCAGAAAATGCTAGG + Intronic
1058986496 9:110212787-110212809 ATGCAGAAGCTGTTTGTGGCTGG - Intergenic
1059260305 9:112969890-112969912 CTGCAGAAGGAGATTGCTCCAGG + Intergenic
1059694371 9:116716783-116716805 ATTCAGAAGCAGATTATGCTGGG + Intronic
1060817416 9:126642494-126642516 TGGGAGAAGCAGAGTTTGCCCGG - Intronic
1189552257 X:42105340-42105362 TTACAGAAGCAGATGCTGGCTGG + Intergenic
1189647885 X:43153980-43154002 TACCAGAAGCACATTGTCCCAGG - Intergenic
1194971973 X:100353677-100353699 TTACAGTAGCAGATCATGCCTGG - Intronic
1196916156 X:120537009-120537031 ATGCAGAATCAGAATGTTCCGGG - Exonic
1200060024 X:153480023-153480045 TTCTAAAAGCAAATTGTGCCAGG + Intronic
1200951952 Y:8906225-8906247 TGGTAGAAGCAGATTGTCCTGGG + Intergenic