ID: 924017424

View in Genome Browser
Species Human (GRCh38)
Location 1:239742605-239742627
Sequence ACACCGCCAGCCCCACTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924017422_924017424 0 Left 924017422 1:239742582-239742604 CCTACTGTAGGTCAAGGCAAGTC 0: 1
1: 0
2: 0
3: 15
4: 150
Right 924017424 1:239742605-239742627 ACACCGCCAGCCCCACTCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 148
924017421_924017424 4 Left 924017421 1:239742578-239742600 CCATCCTACTGTAGGTCAAGGCA 0: 1
1: 0
2: 1
3: 3
4: 82
Right 924017424 1:239742605-239742627 ACACCGCCAGCCCCACTCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 148
924017420_924017424 5 Left 924017420 1:239742577-239742599 CCCATCCTACTGTAGGTCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 924017424 1:239742605-239742627 ACACCGCCAGCCCCACTCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924017424 Original CRISPR ACACCGCCAGCCCCACTCAA GGG Intronic
900416230 1:2535970-2535992 CCACAGCCAGCCCCCCTCAGTGG + Intergenic
901758074 1:11453508-11453530 ACACCACCAGCCACTGTCAATGG + Intergenic
903581888 1:24377283-24377305 ATACCTCCAGCCCCACTCATGGG + Intronic
905234556 1:36536933-36536955 AATCCCCCAGCCCCACCCAAGGG - Intergenic
905435732 1:37954018-37954040 ACACAGTCAGCCCCTCTCCAAGG + Intergenic
905631229 1:39519675-39519697 CCACCCTCAGTCCCACTCAAAGG - Intronic
905666528 1:39766496-39766518 CCACCCTCAGTCCCACTCAAAGG + Intronic
912525895 1:110282248-110282270 AGTCCTCCAGCTCCACTCAAGGG - Intronic
918487579 1:185045647-185045669 TCCCCGCCCGCCCCACTCACCGG - Exonic
922419529 1:225450111-225450133 ACACCTCCAGACCCCCTCCAAGG + Intergenic
922752109 1:228075109-228075131 AGACCCCCAGCCTCACACAATGG + Exonic
924017424 1:239742605-239742627 ACACCGCCAGCCCCACTCAAGGG + Intronic
924104184 1:240634175-240634197 ACACGGCCAGCCCCAGCCTATGG + Intergenic
1068243148 10:54331525-54331547 ATAATGCCAGCCCCACTCATAGG - Intronic
1068533880 10:58218449-58218471 ACAGATCCAGCCCCACTCTAGGG + Intronic
1069893874 10:71668417-71668439 ACTCCCCCAGCCCCACCAAAGGG + Intronic
1070284792 10:75075072-75075094 GCAGCCCCAGCCCCAGTCAAGGG + Intergenic
1070330735 10:75415289-75415311 ACACCTCCACCCCCGCTGAAGGG - Intergenic
1070398723 10:76034426-76034448 ACACTGCCAGCCCCACCGAGGGG - Intronic
1071010618 10:80936155-80936177 GCACCCCCAGCCCCACTAAAAGG - Intergenic
1073002089 10:100293408-100293430 TCACCCCCAGACCCACTGAAAGG + Intronic
1075758301 10:124834115-124834137 ACACAGCAAGCCCCACGCCAGGG + Intronic
1076254673 10:129012567-129012589 ACACCCCCTGCCCCACATAAGGG + Intergenic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1076889982 10:133278717-133278739 ACACCCCCACCCCCACTCGGCGG + Exonic
1077249456 11:1554591-1554613 AGACAGACAGCCCCCCTCAACGG + Exonic
1077301023 11:1847040-1847062 TCACGGCCAGCCCCGCACAACGG - Intergenic
1080967765 11:37233662-37233684 ACTCCTGCAGCCCCACTCAGAGG - Intergenic
1081640101 11:44747130-44747152 ACAGCGCCAGGCCCTCTCACAGG + Intronic
1082175203 11:49050080-49050102 CCACCGCCATCCCCACTCCTAGG - Intergenic
1082833875 11:57638529-57638551 ACCCCGCCAGCCCCTCTCCCGGG - Intergenic
1085512322 11:77094610-77094632 CCACTGCCAGCCCCTCCCAAGGG - Intronic
1085879929 11:80454568-80454590 ACACAGCCAGCCTCACTGGAGGG - Intergenic
1086690563 11:89786003-89786025 CCACCGCCATCCCCACTCCTAGG + Intergenic
1086715235 11:90053656-90053678 CCACCGCCATCCCCACTCCTAGG - Intergenic
1089555356 11:119312989-119313011 CCACCTCCAGCCCCACCCTAGGG + Intronic
1097220866 12:57450262-57450284 ATCCCGCTAGCCCCACTCCAGGG + Exonic
1102171634 12:110846966-110846988 ACACCCCCAGCCCCACGCCCGGG - Exonic
1104910122 12:132236291-132236313 CCACCGCGACCCCCACTCCAGGG - Intronic
1105212045 13:18262629-18262651 ACACAGCCAGCCCCAAGAAAGGG + Intergenic
1107604887 13:42048109-42048131 CCACCCCCAGCCCCACTCCGAGG - Intronic
1109778536 13:67076788-67076810 AGATCACCGGCCCCACTCAATGG + Intronic
1113897467 13:113775436-113775458 TCTCCACCAGCCCCACCCAAAGG - Intronic
1119046719 14:71324854-71324876 ACACCCCCAGCCCCAATCTCTGG - Intronic
1119538830 14:75425814-75425836 ACACGCCCAGCCCTAGTCAATGG - Intergenic
1121380012 14:93456825-93456847 AAACAGACAGCCCCACTCTAAGG - Intronic
1122150869 14:99725500-99725522 CTCCCGCCAGCCCCACTCATGGG - Intronic
1122277894 14:100604556-100604578 CCACCGCCACCCCCACTTCAAGG - Intergenic
1123087547 14:105723790-105723812 CCACCGGGAGCCCCAATCAAGGG - Intergenic
1127089990 15:55457389-55457411 CCACAGCAAGCCCCACCCAAGGG + Intronic
1128678538 15:69629416-69629438 ACTCCCCCAGCCCCACACACAGG - Intergenic
1128683755 15:69668983-69669005 ACACCACCACCCTCACTCAGTGG - Intergenic
1129409083 15:75338954-75338976 ACACCCCCTGCCCCACCCACGGG + Intronic
1129989370 15:79948862-79948884 TCACCCCCACCCCCACTCCAAGG + Intergenic
1134452584 16:14372595-14372617 ACAGCAGCAGCCCCACACAAAGG + Intergenic
1139407249 16:66728963-66728985 ACACCCCCAACCCCACCCTAGGG + Intronic
1140242665 16:73217652-73217674 ACCCCGTCAGGCCCACTCCACGG + Intergenic
1143172829 17:4939901-4939923 TCGCCGCCATCGCCACTCAATGG + Exonic
1143173259 17:4942392-4942414 CCACCCCCAGCCCCGGTCAATGG + Exonic
1143510862 17:7394420-7394442 AGACCGACAGCCCCACCCCAAGG + Exonic
1146056285 17:29582905-29582927 ACCCCTCCAGCCCCACTCACTGG + Exonic
1147013438 17:37470846-37470868 ACACCACTAACACCACTCAAGGG - Intronic
1148091899 17:45027580-45027602 AGACCTTCAGCCCCACTCACCGG - Intronic
1149868010 17:60161383-60161405 ACTCAGCCAACCCCACTCCAAGG - Intronic
1152638544 17:81440052-81440074 TCACCACCAGCCCCACCCAGGGG + Intronic
1154502169 18:15002458-15002480 ACTCTGCCAGCCCCTCCCAAAGG + Intergenic
1157513340 18:48294345-48294367 ACACCCCCACCCCCACTCCCAGG + Intronic
1161122595 19:2537708-2537730 ACACCACAACCCCCACTCCAGGG - Intronic
1161937833 19:7382967-7382989 CCACCACCAGCCCCAGTCACAGG - Intronic
1161976886 19:7612108-7612130 AAACCGCCAGCCCCATCCGAGGG + Exonic
1162339795 19:10085732-10085754 ACACTGCCTGCCCCTATCAAGGG + Intergenic
1163692687 19:18745921-18745943 ACACCGCCGGCCCCTGTCAGTGG + Exonic
1165106687 19:33474209-33474231 ACTCAGGCAGCCCCACTCCACGG + Intronic
1166528902 19:43530653-43530675 ACACCCTCTGCCCCATTCAAGGG + Intronic
1167620847 19:50559641-50559663 CCCCCGCCAGCTCCACTCATAGG + Intronic
927200365 2:20574661-20574683 ACCTGGCCAGCCCCACTCAGTGG + Intronic
932279110 2:70474132-70474154 ACCCCTCCATCCCCACTGAAGGG + Intronic
934301581 2:91779779-91779801 ACACAGCCAGCCCCAAGAAAGGG - Intergenic
938234979 2:129698745-129698767 ACACAGCCAGCTCCACAGAAGGG + Intergenic
938501344 2:131832630-131832652 ACTCTGCCAGCCCCTCCCAAAGG + Intergenic
940849397 2:158673616-158673638 ACAGCCTCAGCCCCACTCAGAGG - Intronic
944369252 2:198962405-198962427 TCACCGCCAGCACCCCTCAGTGG + Intergenic
945115697 2:206406143-206406165 CCACCCCCACCCCCACCCAAAGG - Intergenic
947802800 2:232942051-232942073 AAACCACCACCTCCACTCAAAGG + Intronic
1168812932 20:717977-717999 CCACCCCCCGCCCCACTCCACGG - Intergenic
1169226489 20:3860165-3860187 ACACCCCCCGCCCCACCCATAGG - Intronic
1172025626 20:31946362-31946384 ACACCTCCAGGGCCACTCACAGG + Intronic
1174375608 20:50124718-50124740 CCAACGCCAGCCACACTGAAGGG + Exonic
1175326361 20:58131286-58131308 ACAACACCAGCACCACTCACTGG - Intergenic
1176516595 21:7789108-7789130 GCACCCCCAGTCCCCCTCAAGGG + Intergenic
1178650623 21:34419120-34419142 GCACCCCCAGTCCCCCTCAAGGG + Exonic
1178929148 21:36802333-36802355 GCAACGCCAGCCCAACTGAAAGG + Intronic
1179486560 21:41714214-41714236 ACAGTGCCGGCCCCACTCACAGG + Intergenic
1179658638 21:42860953-42860975 ACACCTCCAGCCACACACAGGGG + Intronic
1180814856 22:18782943-18782965 ACACAGCCAGCCCCAAGAAAGGG + Intergenic
1181201044 22:21217279-21217301 ACACAGCCAGCCCCAAGAAAGGG + Intronic
1181700699 22:24619691-24619713 ACACAGCCAGCCCCAAGAAAGGG - Intronic
1182668640 22:31977309-31977331 ACACCACCAGCCCTACCCTATGG - Intergenic
1184267171 22:43354716-43354738 ACGCTGGCAGCCCCACTCAGTGG + Intergenic
1203225874 22_KI270731v1_random:78149-78171 ACACAGCCAGCCCCAAGAAAGGG - Intergenic
1203264953 22_KI270734v1_random:8634-8656 ACACAGCCAGCCCCAAGAAAGGG + Intergenic
953621458 3:44536304-44536326 ACACTGCCAGCTCCACACAAAGG + Intergenic
954689227 3:52386995-52387017 ACACCACCAGCACCACACAAGGG + Intronic
956401378 3:68883532-68883554 ACAATGCCACCCACACTCAAAGG + Intronic
958755750 3:98247723-98247745 ACACAGCCATCCCCACTCCATGG + Intergenic
961449151 3:126994723-126994745 CCACAGCCAGCCCCACACACAGG - Intronic
963017678 3:140841178-140841200 AGAGCACCAGACCCACTCAAGGG - Intergenic
967976747 3:195039774-195039796 ATTCCACCAGCCCCACTCAGTGG + Intergenic
968302436 3:197627315-197627337 GCCCCGCCAGCCCCACCCACGGG + Intergenic
968440820 4:623677-623699 CCACCCCCAGCCCCACCCCAGGG + Intergenic
968690218 4:1986390-1986412 CGTCCTCCAGCCCCACTCAAAGG - Exonic
969947444 4:10798979-10799001 ACACATGCAGCCCCTCTCAAGGG - Intergenic
970118191 4:12722713-12722735 ATACCTCCAGCCCCGCTCCATGG + Intergenic
971472299 4:27040292-27040314 CCACAGCAAGCCCCACCCAAGGG - Intergenic
983627482 4:169816299-169816321 CCACCGCCAGCCCCAGTAGATGG - Intergenic
986647228 5:9929361-9929383 ACTCCTCCATCCCCACTCCATGG - Intergenic
990890430 5:60643249-60643271 ACACCACCAGCCCCTCAAAAAGG + Intronic
1003331156 6:5129826-5129848 ACTCCACCAGCCACACTGAAGGG + Intronic
1005874726 6:30002264-30002286 ACACAGCCAGCACCACTCTCTGG + Intergenic
1006151379 6:31991963-31991985 ACCCCCCCAGCCCCACCCAGAGG - Intronic
1006157680 6:32024701-32024723 ACCCCCCCAGCCCCACCCAGAGG - Intronic
1006618175 6:35343526-35343548 ACACCTCCACCCCCACCCCATGG - Intronic
1006716734 6:36125117-36125139 TCACTCCCAGACCCACTCAAGGG + Intergenic
1007393979 6:41566795-41566817 CCGCCCCCTGCCCCACTCAAGGG - Intronic
1011498512 6:87962499-87962521 ACAGTCCCACCCCCACTCAAGGG - Intergenic
1017907914 6:158769529-158769551 TCCCCGCCACCCCCACTCCATGG + Intronic
1018198181 6:161373069-161373091 ACACCGGCAGCCCCACACTTTGG - Intronic
1029523522 7:101080028-101080050 CCTCCGCCTTCCCCACTCAAGGG + Intergenic
1030071313 7:105700184-105700206 GCACCACCAGCCCCAGTCATTGG - Intronic
1030899630 7:115106396-115106418 ACACCGTGAGGCCCACACAAGGG - Intergenic
1035015032 7:155758352-155758374 CCACCGCCAACCCCAGTCCACGG - Intronic
1038022475 8:23562023-23562045 AGACTGCCAGCCCTGCTCAATGG + Intronic
1042563148 8:70088591-70088613 ACACAGCCAGCAACACTCAGTGG - Intergenic
1049066475 8:140320462-140320484 TCACCCCTAGCCCCACTCAGGGG + Intronic
1049602080 8:143512674-143512696 ACACTCCCCGCCCCACTCACTGG + Intronic
1050553234 9:6766457-6766479 ACACCGAGACCCCCACTAAAGGG - Intronic
1050957913 9:11687753-11687775 ACACCCCCAACCCCACCCCAGGG - Intergenic
1051562952 9:18463134-18463156 ACAATGCCATCCTCACTCAAAGG - Intergenic
1052278444 9:26705321-26705343 ACAAAGCCAGCCCTATTCAAAGG + Intergenic
1055987194 9:82063611-82063633 ACACCCCCAGCTCCACACCATGG - Intergenic
1056007342 9:82286156-82286178 ACACGTCCAGACCCACTCAGGGG + Intergenic
1056583710 9:87914571-87914593 ACACCCCCAGCTCCACACCATGG + Intergenic
1056584202 9:87918040-87918062 ACACCCCCAGCTCCACACCATGG + Intergenic
1056612667 9:88134885-88134907 ACACCCCCAGCTCCACACCATGG - Intergenic
1056613164 9:88138375-88138397 ACACCCCCAGCTCCACACCATGG - Intergenic
1057159980 9:92882650-92882672 ACACCCCCAGCTCCACACCATGG + Intergenic
1060523609 9:124308276-124308298 ACACCCCCAACCCCACCCCAGGG - Intronic
1062039553 9:134397821-134397843 ACACAGCCCTCCCCACACAAGGG - Intronic
1062500298 9:136849220-136849242 GCTCCGCCAGCCCCGCTTAAAGG - Exonic
1186017791 X:5217855-5217877 ACACCTACAGTCCCACCCAAGGG + Intergenic
1186900866 X:14054114-14054136 ACACCACCACCACCACCCAAAGG - Intergenic
1187342034 X:18429923-18429945 CCACCGCCAGGCCCACCCCAAGG + Intronic
1190935404 X:54994866-54994888 CCACCTCCAGCCCCAGGCAATGG - Intronic
1192175608 X:68883176-68883198 ACACCCTCAGCCCCTCCCAAAGG - Intergenic
1197962797 X:132023795-132023817 ACACCTCCAGCCCTACTCCCAGG - Intergenic