ID: 924019007

View in Genome Browser
Species Human (GRCh38)
Location 1:239760742-239760764
Sequence AATTATGAACAGAGGCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924019007_924019010 23 Left 924019007 1:239760742-239760764 CCTTGATGCCTCTGTTCATAATT 0: 1
1: 0
2: 0
3: 18
4: 208
Right 924019010 1:239760788-239760810 GAAGATTGTATTTTTATCCCTGG 0: 1
1: 0
2: 3
3: 25
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924019007 Original CRISPR AATTATGAACAGAGGCATCA AGG (reversed) Intronic
901256365 1:7830751-7830773 TATTTTCAACAAAGGCATCACGG - Intronic
901809282 1:11757730-11757752 AATTATGTACAGACGCATGGTGG + Intergenic
905742657 1:40386147-40386169 TATTTTGAACAAAAGCATCATGG - Intronic
906991128 1:50740254-50740276 AATTTTAAACAGGGCCATCAAGG + Intronic
907112270 1:51936763-51936785 AGTGATGAAGCGAGGCATCAGGG - Intronic
907779037 1:57547762-57547784 TATTTTGAACAAATGCATCATGG + Intronic
908359401 1:63353854-63353876 AATTTTCCCCAGAGGCATCAGGG - Intergenic
908969085 1:69804720-69804742 AATTAAGATGAGAGGAATCATGG - Intronic
911367201 1:96953081-96953103 TAATATGAATAGAGGCATCAGGG + Intergenic
916021323 1:160795139-160795161 TAATATGGACAAAGGCATCAGGG - Intergenic
917960276 1:180138024-180138046 TATAAAGAACAGAGGCAGCAGGG + Intergenic
919500019 1:198326678-198326700 TATTATGGAAAGAAGCATCATGG - Intergenic
920742268 1:208592263-208592285 CATCATGACCAGAGGCTTCAAGG - Intergenic
921930915 1:220753575-220753597 AAATATGACCAGAGCCATCAGGG - Intronic
922183318 1:223253356-223253378 GATCATGAACATAGGCATGATGG + Intronic
923436289 1:233970694-233970716 ATTTAGGGACAGAGACATCAAGG + Intronic
923719684 1:236456260-236456282 AATGAAGAACAGAGGAATCAGGG - Intronic
924019007 1:239760742-239760764 AATTATGAACAGAGGCATCAAGG - Intronic
924035463 1:239931680-239931702 AAGTATGAACAGAAGCATGTGGG - Intergenic
1063505425 10:6593738-6593760 AATTTAAAACAGAGTCATCAGGG - Intergenic
1065387913 10:25151753-25151775 AATTATAAACACAGGATTCAGGG - Intergenic
1066127866 10:32360289-32360311 AATGAGGAAAAGAGGCAACAGGG - Intronic
1066517461 10:36178895-36178917 AATTCTGAACCCAGACATCAAGG - Intergenic
1069586017 10:69602869-69602891 AATTTGGGACAGATGCATCAGGG + Intergenic
1072038763 10:91588372-91588394 AACTATGAAGAGATGCATAAAGG - Intergenic
1073873222 10:107889956-107889978 AAGTAAGAACAGAGCCATCAGGG - Intergenic
1074790544 10:116882191-116882213 AATTAGGAAAAAAGGAATCAAGG - Exonic
1076978596 11:193399-193421 TATTATGACCAGAGGCTTGAAGG - Intronic
1078152217 11:8768924-8768946 AATTATACACTCAGGCATCATGG + Intronic
1079631755 11:22685873-22685895 TATTGTGAACGGATGCATCAAGG + Intronic
1085499468 11:77006450-77006472 AATGATGAAAAAAGGGATCATGG - Intronic
1085996940 11:81929239-81929261 AAAAATGAACAAAGGCGTCAAGG + Intergenic
1094120526 12:26969400-26969422 TATTATTAACAGAAGCCTCAAGG - Intergenic
1097618949 12:61916894-61916916 AATTATGTACAGATACTTCATGG + Intronic
1097969896 12:65622212-65622234 TGTTCTGAACAGAGGCTTCATGG - Intergenic
1098219438 12:68252971-68252993 AACAATGCACAGAGGCATAAAGG + Intronic
1100149477 12:91718682-91718704 AGTTAGGAACAGAGACATCAGGG + Intergenic
1101001823 12:100364501-100364523 ACTTATGAACAGAGTAACCATGG - Intronic
1101562870 12:105875840-105875862 CATTAAGAACAGAAGCAACAAGG + Intergenic
1101917213 12:108904879-108904901 AATTAAGAATAGAAGGATCATGG + Intergenic
1105802592 13:23921632-23921654 AATGATTAACATAGGCATGAGGG + Intergenic
1106720311 13:32428741-32428763 ATTTATGAACAGTAGCATAAGGG + Intergenic
1107763572 13:43708617-43708639 AATTTTCAACAGAAGCACCAAGG + Intronic
1109095303 13:58106721-58106743 AAAAATGAACAAAGTCATCAAGG - Intergenic
1110650891 13:77939561-77939583 AATTTTTAAGATAGGCATCATGG - Intergenic
1111099253 13:83559991-83560013 ATTGATCAACAGAGGCACCAGGG + Intergenic
1113011994 13:105778709-105778731 AATTACAAAAAGAGCCATCATGG + Intergenic
1114163109 14:20190891-20190913 CATTATGAACAGAGCCCTCAGGG - Intergenic
1117794072 14:59373802-59373824 TATTATCAATAGAGGCAACAGGG - Intergenic
1123133165 14:106004503-106004525 AAATATGAGAAGAGGCATCTCGG + Intergenic
1123663505 15:22587184-22587206 TGTTATGACCAGAGGCAGCAAGG + Intergenic
1124317335 15:28681636-28681658 TGTTATGACCAGAGGCAGCAAGG + Intergenic
1124566108 15:30815867-30815889 TGTTATGACCAGAGGCAGCAAGG - Intergenic
1126412984 15:48391040-48391062 AATTATGATAAGTGGCATGAAGG + Intergenic
1127300709 15:57650983-57651005 AATTATGAGCAGAGTGATGAAGG - Intronic
1127778543 15:62290250-62290272 AATTATGATCACAGGCATGTGGG + Intergenic
1127983708 15:64052118-64052140 AGTTATGAACAGCTGCATCCAGG + Intronic
1129135827 15:73549916-73549938 AATTATGAACAGGAAAATCAAGG + Intronic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1130261873 15:82360827-82360849 ATTTATAAAAAGAGGCAGCATGG - Intergenic
1130279362 15:82508184-82508206 ATTTATAAAAAGAGGCAGCATGG + Intergenic
1132422094 15:101678785-101678807 AATGATGAAAAGAGGAATCAGGG - Intronic
1134641393 16:15832043-15832065 GATTGTGAACAGAGGCCTCCTGG - Intronic
1135886592 16:26315370-26315392 AAATATGAAAAGAGGCAGCCAGG - Intergenic
1137646401 16:50078607-50078629 AATAATGAACAAAGGCAGTAGGG + Intronic
1139243973 16:65422719-65422741 ATATATAAACAGAGACATCATGG + Intergenic
1139654204 16:68377488-68377510 ACATATGACCTGAGGCATCACGG + Intronic
1141075591 16:81004233-81004255 AATTATGAACATCAGCAGCATGG + Intronic
1142466027 17:137890-137912 TATTATGACCAGAGGCTTGAAGG - Intronic
1143297204 17:5880311-5880333 AAACAAGAACAGAAGCATCAGGG - Intronic
1149351763 17:55795997-55796019 AATTCTGCACAGAGGCGTCTAGG + Intronic
1153545910 18:6204429-6204451 GATTGTGACCAGAGGAATCATGG - Intronic
1158609345 18:58924418-58924440 AACCATGAACAGTGGCAGCAAGG - Intronic
1159393059 18:67819885-67819907 AATTCTGAACAGAGAGATAAGGG - Intergenic
1160314452 18:77828479-77828501 AATTATGAATACAGTCATGATGG - Intergenic
1161658811 19:5533321-5533343 AATTTTAAACAGGGTCATCAGGG + Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164889759 19:31813117-31813139 GATTATAAACAGAGGCAGGAAGG + Intergenic
1165240575 19:34463549-34463571 AAATCTGGACAGAGACATCAGGG - Intronic
1167483956 19:49749369-49749391 AATGATGACCAGAGGCCACATGG - Intronic
1167530768 19:50014805-50014827 AAGTATGAGCAGAGGAATGATGG + Intronic
1168368556 19:55811461-55811483 AATGATGAACAGCTGCAGCAGGG + Intronic
925479431 2:4253517-4253539 ATTTATGAAAATAGGCATCCAGG + Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
926433217 2:12811154-12811176 AATTTTGAACAGTGGTATCCTGG + Intergenic
926444102 2:12923005-12923027 TAGTATGAACAGAGGCATGATGG + Intergenic
926557408 2:14375119-14375141 AATGATGAACAGGGAAATCATGG + Intergenic
926605746 2:14896822-14896844 CATTATCAACAGAGACATTATGG - Intergenic
931573372 2:63694104-63694126 ACTTATGAACAGAGGGTTTAAGG + Intronic
931641900 2:64388371-64388393 GATTTTTGACAGAGGCATCAAGG - Intergenic
934912568 2:98272804-98272826 ATTTATGACCAGAGCCCTCATGG - Intronic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
935118396 2:100158378-100158400 AAGGATTAAGAGAGGCATCAGGG - Intergenic
935750820 2:106232443-106232465 AATCATGGAAAGAGGCATCGAGG + Intergenic
936600331 2:113889479-113889501 AACTCGGAACAAAGGCATCAGGG + Intergenic
937591105 2:123614366-123614388 TATTATGAAAAGAGGCATTGAGG + Intergenic
937626956 2:124054682-124054704 AATTATGAAAAGAGTAATCATGG - Intronic
938637563 2:133246033-133246055 AATTATCAAGAAAGGCCTCATGG + Intronic
940628813 2:156211459-156211481 AATTCTGGTCAGAGTCATCAGGG - Intergenic
942334440 2:174867588-174867610 CTTTATGAACAGAGCCATGATGG + Intronic
942372609 2:175301424-175301446 AAGTATGAACCTAGGTATCAAGG + Intergenic
943335543 2:186608975-186608997 AATGATGCAAAGAGGCATGATGG - Intronic
943793169 2:191958560-191958582 AATTATGAACTGAAGTATAAGGG + Intronic
944209354 2:197190361-197190383 AATTATGAATTTAAGCATCATGG + Intronic
946512177 2:220370084-220370106 TATAATGAACAGAGACATCTTGG + Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
947649316 2:231771321-231771343 AATTCTCCAGAGAGGCATCATGG + Intronic
1170163252 20:13337225-13337247 AGTTTTGACCAGAGGCAACAAGG + Intergenic
1173010742 20:39179355-39179377 AATGAGGAACAGAGGAATCCAGG + Intergenic
1177504990 21:22008035-22008057 ATATCTGAACAGAGGGATCAGGG - Intergenic
1178299864 21:31443267-31443289 AATAATGAACAGACATATCAGGG + Intronic
949582573 3:5404588-5404610 AATTATGCCCAGAGGCAACTGGG + Intergenic
950251087 3:11465911-11465933 AGTTATGAATAGAGCCAGCATGG - Intronic
950802430 3:15564823-15564845 AATAATTAACAGAAACATCATGG + Intronic
951144095 3:19205765-19205787 AAGTATGAGCAGAGGCATAAAGG + Intronic
951813262 3:26725103-26725125 AATAATGAACAAGAGCATCAAGG - Intergenic
954311790 3:49774854-49774876 AATTATGACCAGAGGCCTACAGG - Intronic
954765767 3:52914825-52914847 AATTCTGAAAAGAGGCATTTGGG - Intronic
956684587 3:71813047-71813069 ACTTATCAACAGAGGCCTTAAGG - Intergenic
956710880 3:72037718-72037740 ATGTATGAATAAAGGCATCAGGG - Intergenic
958051595 3:88354445-88354467 AATGCTGAACAGAAGCATAAAGG + Intergenic
959300635 3:104596203-104596225 AAATATAAGCAGAGGCCTCAGGG + Intergenic
960464696 3:117983087-117983109 GATTGTGAACAGAGGCTTAATGG - Intergenic
961851326 3:129822161-129822183 AAATATGAACAGTGACATCCTGG - Intronic
965188334 3:165495178-165495200 AATTATGAAATGTTGCATCAAGG - Intergenic
965429440 3:168568318-168568340 ATTTATGAACAGAGCAATTAAGG + Intergenic
966989199 3:185211531-185211553 AATCGTGAACACAGACATCAAGG + Intronic
968125525 3:196157089-196157111 AAATATGAACAAAGGCTCCAAGG - Intergenic
969922586 4:10554128-10554150 AATTAAAAACAGAGACATCTGGG - Intronic
972210403 4:36829857-36829879 AAATAAAAACAAAGGCATCAAGG + Intergenic
972229822 4:37058601-37058623 TTTTATGATCAGAGTCATCAGGG + Intergenic
974050292 4:56935842-56935864 AATAATAAACAAAGGCATCATGG - Exonic
974183654 4:58416862-58416884 AATTATGAACATACACATTATGG + Intergenic
974507095 4:62789849-62789871 AATAAAGAACAGAGCCATGAAGG + Intergenic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
975568259 4:75783991-75784013 AGTTTTGAACAAAGGTATCAAGG - Intronic
978643376 4:110898021-110898043 AAGGAGGAAGAGAGGCATCAAGG - Intergenic
979003463 4:115257982-115258004 AATAATGAACAGAGTAAACAGGG + Intergenic
979432916 4:120653235-120653257 AATTATATCCAGAGACATCAGGG - Intergenic
982829990 4:160047102-160047124 AATTTTGAACAGAAGAATAACGG + Intergenic
983771026 4:171549246-171549268 CAGTATGAAGAAAGGCATCATGG + Intergenic
984934785 4:184880670-184880692 CCTTATGAAAAGAGGCAACATGG - Intergenic
987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG + Exonic
987776784 5:22376995-22377017 AATTACCACCAGAGGCATCATGG + Intronic
987905839 5:24075874-24075896 AAATAAGAACAGAGCCCTCAGGG + Intronic
990175058 5:53098788-53098810 AATCATGACGAGAGACATCATGG + Intronic
992739806 5:79762350-79762372 AGACATGAGCAGAGGCATCAAGG + Intronic
993108410 5:83626285-83626307 ACTTATCAACAAAGACATCATGG + Intergenic
993206096 5:84880552-84880574 AATTATGAACAGCTGAATGAAGG + Intergenic
994415439 5:99464092-99464114 AATGTAGGACAGAGGCATCATGG + Intergenic
995758033 5:115531987-115532009 AATCAAGAACAGAGGCATAGAGG - Intronic
997148063 5:131459038-131459060 AAGTATGAAGAGAGTCATAAGGG + Intronic
998537894 5:142951461-142951483 AATAATACACAGAGGCACCAGGG - Intronic
998820612 5:146054436-146054458 TCTTTTGAACAGAGGCCTCAAGG - Intronic
1000732460 5:164853270-164853292 TATCATGAACAGAGGCATGGAGG + Intergenic
1000838197 5:166182127-166182149 AATTATGATCAAATGCATGAAGG - Intergenic
1001024546 5:168213029-168213051 CATTATCAACAGAAGGATCAAGG - Intronic
1003730991 6:8824408-8824430 AATAATGAAGAAAGGCATCTGGG + Intergenic
1004720218 6:18262342-18262364 ACTTTAGAACTGAGGCATCATGG - Intronic
1005273691 6:24193570-24193592 AATTATTAACCTAGGCAACAGGG + Intronic
1005775586 6:29128353-29128375 AAAGATGAACAGTGGCATCCAGG + Intergenic
1005781671 6:29199852-29199874 AAATATGAACAGTGGCATCCAGG + Intergenic
1007328692 6:41085643-41085665 ATTTATGAGCAGTGGGATCATGG - Intronic
1008137419 6:47793235-47793257 ATTTAAAAACAGAGGTATCAGGG - Intronic
1008333357 6:50269774-50269796 AATTATGTTCAGAGGAATCATGG - Intergenic
1011710268 6:90045960-90045982 AGATATGAACAGAGTCCTCATGG - Intronic
1011829394 6:91352943-91352965 AATTATAAATAGAGATATCATGG - Intergenic
1012742890 6:103042639-103042661 ATTTCTGAACCGAGGCCTCAAGG - Intergenic
1013287725 6:108695251-108695273 AATAATGAAGAAAGGCCTCATGG + Intergenic
1013975343 6:116071217-116071239 CATTATGTACATAGGCAACAAGG - Intergenic
1014945768 6:127495386-127495408 AATTATAAACAAAGGCCTTAAGG - Intronic
1015425941 6:133067533-133067555 AATTATGGCCAAAGGGATCATGG + Intergenic
1015623791 6:135159174-135159196 GATTATGAAGAGAGAAATCAAGG + Intergenic
1016450065 6:144173283-144173305 AATTATGAACATAGGTTTTAGGG - Intronic
1017080087 6:150660051-150660073 AATTATGAACAAAGACATTTGGG - Intronic
1021698630 7:23297064-23297086 ATTTATGAACAAAGGGATGAGGG + Intergenic
1022139052 7:27476288-27476310 AATTCTGCTCAGGGGCATCAGGG - Intergenic
1023127175 7:36965925-36965947 AAATATGAACACAGGCAGGATGG - Intronic
1023490917 7:40740717-40740739 TATTATGAATAAATGCATCAAGG + Intronic
1024497590 7:50066162-50066184 GATTATGAACATATGCAGCATGG + Intronic
1026296706 7:69059263-69059285 AATTAGCAGCAGAGGCATCCTGG - Intergenic
1027250354 7:76395087-76395109 AATTATGAGCAGACGGAGCAAGG - Intronic
1028303107 7:89227649-89227671 AATTATGAACAAGGGCCTAAAGG + Intronic
1030257428 7:107526371-107526393 AATTATGAACTGCTGCATCATGG + Intronic
1032480445 7:132242004-132242026 AGTTATGTAAAGAGACATCAAGG - Intronic
1032850309 7:135789281-135789303 ATTTAGGAGCAGAGGCATCAAGG + Intergenic
1036108347 8:5868599-5868621 AGTTATGACCAGAGGTATAAAGG + Intergenic
1036419952 8:8586200-8586222 AGTTTTGAGCAGAGGAATCATGG - Intergenic
1036735417 8:11310526-11310548 AGTTAGCAACAGAGCCATCAAGG + Intronic
1037726267 8:21484929-21484951 AATTCTGAACAGATGCAATATGG + Intergenic
1039459620 8:37732648-37732670 TATAATGAACACATGCATCATGG - Intergenic
1044498745 8:92926236-92926258 ATTTAAGTACAGAGACATCATGG - Intronic
1045296208 8:100873547-100873569 ATATATGAACAGAGCCTTCAAGG + Intergenic
1045992572 8:108326570-108326592 AATTCAGAATTGAGGCATCAGGG + Intronic
1046866451 8:119156207-119156229 ATTTAGGAAAAGAGACATCAGGG - Intergenic
1047532848 8:125693094-125693116 ATTTATAAACAAAGGCCTCAGGG + Intergenic
1050245543 9:3685828-3685850 TACTATGAGCAAAGGCATCAAGG + Intergenic
1050766542 9:9141576-9141598 AATTATGTAAAGAGGAAACATGG - Intronic
1051078710 9:13271824-13271846 AACTATGAATACAGGCAACATGG + Intronic
1051293209 9:15566940-15566962 AATTTTCAACAGAAGTATCAAGG - Intronic
1051860614 9:21621619-21621641 AATTAAGAGAAGAGGCACCATGG + Intergenic
1051952629 9:22654985-22655007 AATCATGAACAGTGAAATCAAGG - Intergenic
1051964398 9:22809640-22809662 AATAAAGAATAGAGGAATCAAGG + Intergenic
1052137215 9:24927626-24927648 AAATATGTACACAGGCATAATGG + Intergenic
1052254910 9:26444828-26444850 ATATATGAACAGGGGCATCAGGG + Intergenic
1056827491 9:89886730-89886752 AGGTATAAACAGAGGCATCGAGG + Intergenic
1057741909 9:97719422-97719444 AAAGATGAAGAAAGGCATCATGG + Intergenic
1058604369 9:106704872-106704894 TATTCTGATGAGAGGCATCAAGG + Intergenic
1058930022 9:109709701-109709723 ACTGATGGACACAGGCATCAGGG + Intronic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1060614034 9:124994964-124994986 AATGATGAACAGTGGCTTCCTGG + Exonic
1061124320 9:128664299-128664321 GCTTTTGAACAGAGACATCAAGG - Intergenic
1185919537 X:4075077-4075099 AATGAAGATCAGAGGTATCATGG + Intergenic
1186638837 X:11433595-11433617 GATTATGATCAGAGGAATGAAGG - Intronic
1186809436 X:13173764-13173786 AATTATGAACTGAGAAATCCAGG - Intergenic
1188052666 X:25506928-25506950 GATTATGAACAAAAGAATCATGG + Intergenic
1188107408 X:26161017-26161039 CCTGAGGAACAGAGGCATCACGG - Intergenic
1188376982 X:29443474-29443496 CATTATGAACAGAGTCACAAAGG - Intronic
1189639802 X:43056060-43056082 AGTTATTAACAGAGACATCAAGG + Intergenic
1190467548 X:50741067-50741089 GATTTTCAACAAAGGCATCAAGG - Intronic
1192938390 X:75885602-75885624 AATTATGAACAGATACATATTGG + Intergenic
1193547110 X:82844357-82844379 CATAATTAACAGAGGCAGCATGG + Intergenic
1193669104 X:84361674-84361696 TATTATAAAGAGAAGCATCAGGG + Intronic
1196405212 X:115354193-115354215 AATTTTGAACAGAGTTATGATGG - Intergenic
1199780295 X:151052129-151052151 CACTAGGAACAGTGGCATCAAGG - Intergenic
1202367206 Y:24173633-24173655 AATTATGACCAGTGGAACCAAGG - Intergenic
1202503575 Y:25496490-25496512 AATTATGACCAGTGGAACCAAGG + Intergenic