ID: 924021199

View in Genome Browser
Species Human (GRCh38)
Location 1:239785543-239785565
Sequence ATGGAGAGGAAGACTGACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924021199 Original CRISPR ATGGAGAGGAAGACTGACGA GGG (reversed) Intronic
900666395 1:3818145-3818167 CTGGGGAGGAAGCCTGACGAGGG - Intronic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
903587301 1:24425895-24425917 ATTGCCAGGAAGACTGACAAAGG - Intronic
905630731 1:39516831-39516853 ATGGAGATAAAAACTGACGAGGG + Intronic
905667029 1:39769339-39769361 ATGGAGATAAAAACTGACGAGGG - Intronic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
907673339 1:56496110-56496132 ATGGACAGAAAGACTCAAGAGGG + Exonic
908429025 1:64037910-64037932 ATGGAGAGCAAGGCTGCAGAGGG - Intronic
909604628 1:77496106-77496128 ATGGGGAGCAAGACTGAAGTAGG + Intronic
909742852 1:79054210-79054232 AGGAAGAGGAAGACTGGGGAGGG + Intergenic
910384209 1:86664234-86664256 AAGGAGAGGAGCACTGAAGAAGG + Intergenic
911421137 1:97642133-97642155 ATGGAGAGGAAGAATCAATATGG + Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911967549 1:104386817-104386839 TTGGAGAGGAAGAGTGAAGGAGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
921353035 1:214256939-214256961 ATGGAGTGGAGGACTGAGAAGGG + Intergenic
921403149 1:214748908-214748930 AAGGAGAGGAAGACCAAAGAAGG - Intergenic
921736009 1:218629406-218629428 ATGGATAGGAAGAATGATTATGG - Intergenic
922802328 1:228370166-228370188 AGGGAGAGGAAGGCTCAGGAGGG - Intronic
923243954 1:232112806-232112828 ATGGATAAGAAGACTGTCAAAGG - Intergenic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924823960 1:247521316-247521338 AGGGAGAGGGAGACTGGAGAGGG - Intronic
1063109385 10:3021262-3021284 TTAGAGAGGAAGACTGGAGATGG - Intergenic
1064513384 10:16119776-16119798 ATGGTAAGGAAAACTGAAGAAGG - Intergenic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069898198 10:71691895-71691917 ATGGGTACGAAGACTGAGGAAGG + Intronic
1070758840 10:79010584-79010606 ATGAAGAGTAAGAGTGATGATGG - Intergenic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071909652 10:90217104-90217126 ATCTAGAGGAAGACAGACGATGG - Intergenic
1072872214 10:99132585-99132607 ATGGAGAGCAAGACGAAGGAGGG + Intronic
1072900551 10:99403207-99403229 ATGGAGAGGAAGACTGGGTGGGG + Intronic
1073468867 10:103710532-103710554 ATGGAGAGGATGACTGTCTGTGG - Intronic
1073948434 10:108779483-108779505 ATGGATAGGAAGACTCAGTATGG - Intergenic
1074011290 10:109483423-109483445 ATGGAGAGGATGACTAAGAAGGG + Intergenic
1074146464 10:110721151-110721173 GTGCTGAGGAAGACTGAGGAAGG - Intronic
1074429063 10:113377860-113377882 ATTGAGATGAAGTCTGAAGAAGG + Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076379973 10:130018254-130018276 TTGGAGAGGAAAACTCACCAAGG + Intergenic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1077292399 11:1803995-1804017 ATGGAGGGGAAGACGGCCCAGGG + Intergenic
1077742715 11:4864871-4864893 ATGGATAGGAAGACTTTTGATGG - Intronic
1079032416 11:16995509-16995531 ATGGAGAGTAACACTCAGGAGGG - Intronic
1079250627 11:18784795-18784817 ATGGAGAGGAAGATAGATCATGG - Intronic
1079510732 11:21206701-21206723 CTTGAGAGAAAGACTGACAAAGG - Intronic
1081115458 11:39193620-39193642 ATGGAGAGGGAGAGTGGCTAAGG + Intergenic
1081705313 11:45179638-45179660 AAGGAGAGGAAGACACACCAGGG - Intronic
1084726677 11:70946550-70946572 GTGGAGAGGAAGGCTGACCCTGG - Intronic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1085413623 11:76306279-76306301 AAGGTGAGGAAGACAGAGGAGGG - Intergenic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086496143 11:87406271-87406293 TGGGAGGGGAAGACTGACAAGGG + Intergenic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087086474 11:94224083-94224105 AAGGAGAGGAAAACAGATGAAGG - Intergenic
1087859259 11:103133291-103133313 ACGGAAAGGAAGAATGAAGAAGG - Intronic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1091952892 12:4609599-4609621 ATGGAGGGAATGACTGATGAGGG + Intronic
1096761001 12:53841949-53841971 ATGGGGAGCAAGAGTGAGGAGGG - Intergenic
1096848768 12:54422022-54422044 ATGGAGAGGAAGAAGGGTGAAGG + Intergenic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1099248780 12:80226520-80226542 ATGGGAAGGAAAACTGAGGAAGG - Intronic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100422554 12:94450744-94450766 ATGGATTGGAAGACTCAAGATGG + Intronic
1100620995 12:96272814-96272836 AGGGAGAGAAAGACTGAAGCTGG - Intergenic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1101376078 12:104172482-104172504 ATGGAGTGGAAGAGTAAGGAAGG + Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102913422 12:116736267-116736289 ATAGAGAGGAAGGCAGAGGACGG + Intronic
1103212339 12:119176151-119176173 AAGGAGGGGAAGCCTGGCGAAGG - Intergenic
1104938150 12:132377969-132377991 ATGGAGAGGGAGAGAGACGGGGG + Intergenic
1104938229 12:132378474-132378496 ATGGAGAGGGAGAGAGACGGGGG + Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106042933 13:26111186-26111208 GTGGAGAGGAAGGGTGCCGAGGG - Intergenic
1108177460 13:47807871-47807893 AAGGAGATGAAAACTGATGAAGG + Intergenic
1110496896 13:76178469-76178491 GTGGAGAGAAAGAGTGAAGACGG + Intergenic
1111195398 13:84869806-84869828 AAGTGGAGGACGACTGACGAAGG + Intergenic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1112724384 13:102285925-102285947 TTGGTGAGGAAGACTAAGGAGGG + Intronic
1113613312 13:111663395-111663417 AAGGCGAGGAAGAAGGACGAGGG - Intronic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1118739369 14:68727954-68727976 ATGGGGAGGAAGCTTGACCATGG + Intronic
1120544126 14:85789347-85789369 ATGGAGAGGAAGAGAGACAAAGG - Intergenic
1121413911 14:93765734-93765756 AGGGAGAGGAAGAATGTCTAAGG - Intronic
1121669721 14:95699162-95699184 ATGTAGAGAAACACTGACAAAGG + Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1123986219 15:25648545-25648567 ATGGAGAGGATGACAGATGGAGG + Intergenic
1124035027 15:26046756-26046778 ATTGATAGGAACACTGAGGATGG - Intergenic
1126333169 15:47555973-47555995 AAGGAGAGAAACACTGATGAGGG - Intronic
1126405679 15:48320310-48320332 TTGGCGAGGAAGACGGAAGAAGG + Intergenic
1128054887 15:64692091-64692113 ATGGGGAGGAAGTCTCAGGAGGG + Intronic
1128314933 15:66654484-66654506 ATAGACAGGAAGCCTGACGGAGG - Intronic
1129149598 15:73679721-73679743 ATGGGGAGGAAGACAGATAATGG + Intergenic
1131139818 15:89968096-89968118 AGGGAGAGGAAGAGAGAAGAAGG + Intergenic
1131184266 15:90261931-90261953 AGGGAAAGGAAGACTGACTAAGG - Intronic
1131442547 15:92469871-92469893 ATGGTGAGGAAGACTGAGAAAGG - Intergenic
1132091173 15:98949003-98949025 ATGGAGAGGATGAGTAAGGATGG - Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1138833016 16:60398704-60398726 ATGGAGAGGCTGACTAAAGAAGG - Intergenic
1140315003 16:73888072-73888094 AGGGAGAGGAAGACGGAGGTGGG - Intergenic
1140430537 16:74899071-74899093 TGGGAGAGGAAGACAGAAGAGGG + Intronic
1140846027 16:78888975-78888997 GTGGTGAGGAGGACTGACCAGGG - Intronic
1141640540 16:85338451-85338473 ATGGAGGGGGAGACTGAGGCAGG - Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142493089 17:291080-291102 GTGGAGATGAACACTGAAGATGG + Intronic
1142736667 17:1905148-1905170 ATGGAGAGCAAGACAGAACAGGG - Intergenic
1143627780 17:8121171-8121193 ATGGAGAGCAGGACTGAGGGTGG + Exonic
1146475202 17:33157136-33157158 AGGGAGAGGGACACTGAGGAGGG - Intronic
1146926694 17:36750512-36750534 GTGGACAGGAAGCCTGAGGACGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149258337 17:54852159-54852181 ATGGAAGGGAAGACAGACTAGGG + Intergenic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1153153900 18:2127450-2127472 TTGGAAAGGAAGACTGAGAAGGG - Intergenic
1154059572 18:11047070-11047092 ATGGAAAGGATGAGTGAAGACGG - Intronic
1155343708 18:24838118-24838140 ATGGAGAGGAAGAGAGAAGGTGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1158100405 18:53823423-53823445 ATGGAGAGGAAGAATCAATATGG + Intergenic
1160016090 18:75141797-75141819 ATGGAGCGGAGGACTGAAGCGGG - Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1161299855 19:3537387-3537409 ATGGAGGGGGAGGCTGACCAAGG + Intronic
1162639094 19:11993714-11993736 ATGGAGATCAAGAGTGAAGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166213896 19:41323654-41323676 AGGGAGAGGAAGGCGGAGGAAGG - Exonic
1167751878 19:51385775-51385797 CTGGAGAGGTAGACTGAGGCAGG - Intronic
1167775610 19:51552850-51552872 AGGGAGAGAAAGACAGAAGAGGG + Intergenic
925642349 2:5998271-5998293 ATGAAGAGAAAGACTGGAGAGGG + Intergenic
927166243 2:20325332-20325354 ATGGAGAGTAAAAGTGACCACGG - Intronic
927440236 2:23110584-23110606 ATGGATAGGAAGAATGAAAATGG - Intergenic
930878779 2:56248805-56248827 ATGGTGAGGAAGCCTGAAGAGGG + Intronic
931617862 2:64179558-64179580 ATGGTGAGCAAAACTGACCAAGG + Intergenic
932569135 2:72928754-72928776 ATGCACAGGAAGAATGACTAGGG + Intronic
934847943 2:97674714-97674736 ATTGGGAGGAAGACTGTAGAGGG - Intergenic
934903090 2:98176478-98176500 AGGGAGGGGAAGACCGAAGAAGG - Intronic
935634493 2:105239526-105239548 ATGGAGAGGAATGCAGATGAAGG + Intergenic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
938012359 2:127839113-127839135 AAGGAAAGGAAGACAGAAGAAGG - Intergenic
940184816 2:150972203-150972225 AGGGAGAGGAAGAGAGATGAGGG + Intergenic
941174576 2:162180918-162180940 AAGGAAAGGAAGACTAATGAGGG + Intronic
941916540 2:170817243-170817265 AGGGATAAGAAGAGTGACGAGGG - Intronic
941922223 2:170862681-170862703 AGGGAGAGCAAGGCTGACGGTGG + Intergenic
942593663 2:177571861-177571883 ATGGAGAGGTAAACTGAGGTTGG + Intergenic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
946326871 2:218989159-218989181 AGGGAAAGGAAGAGTGAAGAGGG + Intergenic
946574076 2:221055501-221055523 ATGGAGAGGAAGACAGACATTGG - Intergenic
946803652 2:223448429-223448451 ATGGTCAGGATGACTGACCAAGG - Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
1169038088 20:2470199-2470221 ATGGAGAGGAGGGCGGAGGAGGG - Intronic
1171316519 20:24200369-24200391 ATTGAAGGGAAGACTGAGGAGGG - Intergenic
1173434156 20:43017421-43017443 ATGGAGAGCAAGACCGAGGTGGG - Intronic
1175577461 20:60071832-60071854 ATGAAGAGGAACATTGACGAAGG - Exonic
1177047067 21:16183861-16183883 AGGGAGAGGAAGGGAGACGAGGG - Intergenic
1177336760 21:19738196-19738218 ATGGACATGAAGTCTGACAATGG - Intergenic
1177824867 21:26071343-26071365 CTGGAGAGGGAAACTGAAGATGG - Intronic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180613212 22:17110850-17110872 ATGGAGTGGAAGCCTGCCCAGGG + Exonic
1180715866 22:17871923-17871945 ATGGAGAGGCTGAGTGCCGAGGG - Exonic
1182185597 22:28398344-28398366 ATGGAGAGGGAGCCAGAAGAGGG + Intronic
1183600624 22:38838225-38838247 ATGGAGGGGAAAACTGAAGCTGG + Intronic
1184345160 22:43908742-43908764 TTGGTGAGGGAGAATGACGAGGG + Intergenic
949204642 3:1423501-1423523 AGGGAGAGGCAGACTGATGCAGG - Intergenic
949493837 3:4613221-4613243 ATTTAGTGGAAGACTGACAAAGG - Intronic
954494828 3:50947758-50947780 ATGGAGTGGAAGACTCAATATGG + Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
958781843 3:98552196-98552218 AAGGAGAGTGACACTGACGAAGG + Intronic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959840217 3:110966588-110966610 ATAGAGAGAAAGACTGAGAAGGG + Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961278646 3:125747309-125747331 ATGGAGAGGAAGAAGTACGTGGG - Intergenic
964190587 3:153995960-153995982 AAGAAGAGGAAGACTCACTAGGG - Intergenic
967135206 3:186507288-186507310 ATGGAGAGGAAGAGTCAAGTGGG + Intergenic
968664324 4:1812667-1812689 ATGACGAGGGAGAATGACGAGGG + Exonic
969433957 4:7173321-7173343 AGGGAGAGGAGTGCTGACGAGGG + Intergenic
969919357 4:10523168-10523190 TGGGATAGGAAGAGTGACGATGG + Intronic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
973573978 4:52267344-52267366 ATGGAGAGCAAGACTTCCAATGG - Intergenic
974669392 4:65009373-65009395 AAGGAGAGAAAAATTGACGAGGG + Intergenic
975287914 4:72641730-72641752 TTGGAGAGGAAGAGTGACTCTGG - Intergenic
975814730 4:78205886-78205908 CTTGAGAGGAAGCCTGAGGAAGG + Intronic
976894004 4:90085222-90085244 TTGGAGAGGGAGTCTGACCACGG + Intergenic
977023290 4:91784428-91784450 ATGGAGAGAAAGACTTATTAAGG + Intergenic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
982129133 4:152211554-152211576 AGAGAGAGAAAGACAGACGAAGG + Intergenic
985268346 4:188171207-188171229 ATAGAGATGATGACTGAAGAGGG + Intergenic
986151098 5:5131186-5131208 ATGCAGAGGAACAGTGACTAGGG + Intergenic
989018421 5:36969188-36969210 ATGGATAGGAAGACTCAATAGGG + Intronic
990354286 5:54950601-54950623 ATGGAGGGGAAGACAGCCGGAGG + Intergenic
990507059 5:56455503-56455525 ATGGACAGGAAGCCTGGAGATGG - Intergenic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
993551307 5:89277257-89277279 GTTGAGAGGAAGGCTGAAGAAGG - Intergenic
994612363 5:102059383-102059405 GTGGAGAGGAAGAATAACAAGGG + Intergenic
995038513 5:107562337-107562359 ATGGAGAGAGAGACAGACGATGG - Intronic
997824577 5:137095038-137095060 ATGGAGAGGGAGAGAGACAAGGG + Intronic
998127834 5:139636149-139636171 ATGGAAAGGGGGACTGACAAGGG + Intergenic
998628585 5:143873692-143873714 GTAGGGAGGAAGACTGAAGAGGG - Intergenic
999177703 5:149642966-149642988 ATGGCAAGGAAAACTGGCGATGG - Intergenic
1000510676 5:162178135-162178157 GTGGATAGGAAAACTGATGAAGG - Intergenic
1001095970 5:168775750-168775772 ATGGATAGGAAGGCTGACCCTGG - Intronic
1001744648 5:174082992-174083014 AAGCAGAGGAAGCCTGAGGAAGG - Intronic
1002013352 5:176302934-176302956 ATGGAGTGGAAGACTTAATATGG + Intronic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1004394938 6:15239413-15239435 TTGGAGAGGATGACAGAAGAAGG + Intergenic
1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG + Intergenic
1005979347 6:30824486-30824508 AAGGAGAGGAAGAATGACTCTGG + Intergenic
1006012351 6:31053765-31053787 AAGGAGAGGAACACTCATGAGGG - Intergenic
1006709136 6:36050278-36050300 AGGGAGATGAAGACAGAAGAGGG + Intronic
1007057549 6:38902732-38902754 ATAGAGAGGAAGACTCAGCAGGG + Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1008183310 6:48360765-48360787 AGGGAGAGGAACACTGTCGGTGG + Intergenic
1010998962 6:82565622-82565644 ATAGAGAGGAAGAGTAATGATGG - Intergenic
1011427713 6:87248816-87248838 GTGGTGAGTAAGACTGAAGAAGG - Intronic
1011727077 6:90220545-90220567 ATGGAAATGAGGACTGACAAGGG - Intronic
1012476987 6:99624518-99624540 ATGGAGATGAACACAGAGGAAGG + Intergenic
1016060417 6:139624002-139624024 ATAGTGAGAAAGACTGAGGAAGG + Intergenic
1016922859 6:149313457-149313479 AAGGAGAGGAAGGGTGACGAGGG - Intronic
1016991635 6:149933764-149933786 ATGGAGAGGAAGAGTGGGAAGGG + Intergenic
1017162155 6:151375397-151375419 ATGGACAGGAAGACTCAACATGG + Intronic
1017799568 6:157881347-157881369 AAGGAGAGGGAGAAAGACGAGGG - Intronic
1018099580 6:160424801-160424823 ATCTTGAGGAAGACTGAGGAAGG + Intronic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1021781506 7:24111281-24111303 ATGGAGAGGTAGAAAGACCATGG + Intergenic
1022374671 7:29802432-29802454 ATGGAGGGGAGGACTGAGAAAGG + Intergenic
1022600453 7:31753563-31753585 ATGGAAAGGAAGACAGACAACGG + Intronic
1026373050 7:69721088-69721110 AAGGAGATGAAGAATGACCAGGG + Intronic
1026789764 7:73324075-73324097 AGGGAGAGGAAGAGGGAAGAGGG + Intronic
1028125081 7:87103764-87103786 AAGGAGAGGAATACAGACCAAGG + Intergenic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1030444313 7:109629903-109629925 ATGGCCAGGAGGACTGGCGATGG - Intergenic
1030994700 7:116345425-116345447 ATTGAGAGGAAGAATCACAAGGG - Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1036832719 8:12034386-12034408 TTGGAGAGGAAGAATTACGTGGG + Intergenic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037706628 8:21321038-21321060 ATGGACAGCAAGACTGAAGATGG - Intergenic
1037888582 8:22608695-22608717 AGGGAGAGTGAGACTGAGGAAGG - Intronic
1038328141 8:26587884-26587906 ATAGAGGGGAAGACTGAGGCCGG + Intronic
1039109623 8:34027641-34027663 ATGGAGAGACAGACTGGTGAGGG - Intergenic
1040892410 8:52330938-52330960 ATGGAGAGGCAGACAGACAGAGG + Intronic
1040897540 8:52384436-52384458 ATGGAGAGGATGAGTGAAGTGGG - Intronic
1041539431 8:58966487-58966509 ATGGAGAGGAAGAATGGCCTGGG + Intronic
1041706163 8:60848492-60848514 CTGGAGAGGAAGACAGAGGGGGG - Intronic
1042093646 8:65188024-65188046 GGGGAGAGGAAGACTGAAGAGGG - Intergenic
1042320146 8:67467360-67467382 ATGGAGGGGAAGATAGACAATGG - Intronic
1042778803 8:72467224-72467246 ATTGAAAGGATGACTGAGGATGG - Intergenic
1043632583 8:82354857-82354879 AAGGAGATGAATACTGAAGAAGG + Intergenic
1044015349 8:87043871-87043893 ATGGGGAGGAAGTATGACCAGGG - Intronic
1045833326 8:106490712-106490734 ATGGTGAGAAGGACTGAAGATGG + Intronic
1046182188 8:110665308-110665330 ATGGAGTGGAAGAATCATGAGGG - Intergenic
1048074990 8:131060505-131060527 ATGGAGAGCTAGACAGAGGATGG - Intergenic
1048460055 8:134614131-134614153 ATGGGAAGGAAGCCTGATGAAGG - Intronic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1051809870 9:21036755-21036777 ATGGAAAGGAAGACTGTCAAGGG - Intergenic
1052022032 9:23536784-23536806 ATGAAGAGGAAGGTTGACCATGG - Intergenic
1052620302 9:30899812-30899834 ATTGAGAGGAAGACTACTGAGGG + Intergenic
1052843655 9:33315448-33315470 ATGTAGAGAAAGGCAGACGAAGG - Intronic
1053148697 9:35729442-35729464 AGGCAGAGGAAGACTGGAGAGGG + Intronic
1053301137 9:36950476-36950498 CTTGGGAGGAAGACTGAGGAGGG - Intronic
1055342938 9:75304590-75304612 ATGGAGAGGAAGAATCAATATGG - Intergenic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1056425473 9:86471262-86471284 ATGGAAAAGAAGACTGGCAACGG + Intergenic
1056506929 9:87266240-87266262 CTTGAGAGGAAGGCTGAAGAAGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059585408 9:115600851-115600873 AAGGAGAGGAAGAAAGACCAAGG + Intergenic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1060268021 9:122123425-122123447 ACGGAGATGAGGACTGAAGAGGG - Intergenic
1060695943 9:125708955-125708977 ATGGAGAGTAAGATTTAGGAAGG - Intergenic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061324628 9:129856140-129856162 TTGGACAGGAAGTCTGGCGAAGG + Intronic
1061618911 9:131798249-131798271 GTGGTGGGGAAGACTGAGGAAGG - Intergenic
1062698285 9:137886380-137886402 ATGGACGGGAAGGCAGACGAAGG - Intronic
1186581497 X:10824706-10824728 ATGTAGAGGAAAAATTACGAAGG + Intronic
1187433563 X:19246854-19246876 ATGGAGAGGTGGTCTGATGATGG - Intergenic
1188583335 X:31742491-31742513 AAGGAGAGGAAGAGAGATGAGGG + Intronic
1191921651 X:66263034-66263056 AGGGAGAGGAAGACTGAGCCAGG + Intronic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193738801 X:85193228-85193250 ATGGGGAGGAAAAATGATGATGG + Intergenic
1194968061 X:100312162-100312184 TGGGAGAGCAAGACTGATGATGG + Intronic