ID: 924023664

View in Genome Browser
Species Human (GRCh38)
Location 1:239810737-239810759
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924023664_924023665 16 Left 924023664 1:239810737-239810759 CCATGAGGTTGAACTATTTAGTT 0: 1
1: 0
2: 1
3: 15
4: 160
Right 924023665 1:239810776-239810798 ACCTGTTTATCAACCCTTTGAGG 0: 1
1: 0
2: 1
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924023664 Original CRISPR AACTAAATAGTTCAACCTCA TGG (reversed) Intronic