ID: 924027075

View in Genome Browser
Species Human (GRCh38)
Location 1:239844932-239844954
Sequence CAGTGTGAACTAAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 1, 2: 0, 3: 37, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924027072_924027075 -1 Left 924027072 1:239844910-239844932 CCAGAACTTTGTACATGGAATGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG 0: 1
1: 1
2: 0
3: 37
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924027075 Original CRISPR CAGTGTGAACTAAGGAAAGA GGG Intronic
900462079 1:2806357-2806379 AGGTGTGAAGGAAGGAAAGAGGG + Intergenic
902421871 1:16287131-16287153 CAGAGTGAACAAAGGAGAGGAGG - Intronic
902453570 1:16515255-16515277 CACTGTGAAGTAAGCAAAGTTGG + Intergenic
902473625 1:16667919-16667941 CACTGTGAAGTAAGCAAAGTTGG + Intergenic
902485178 1:16739523-16739545 CACTGTGAAGTAAGCAAAGTTGG - Intergenic
902498912 1:16895007-16895029 CACTGTGAAGTAAGCAAAGTTGG - Intronic
906074343 1:43041137-43041159 GAGTGTGAACTCAGGATACAGGG + Intergenic
906697164 1:47830745-47830767 CACTGTGAGCCAGGGAAAGACGG + Intronic
907964549 1:59316528-59316550 CAGTGTGAAAAAAGGAAAAGGGG - Intronic
908569889 1:65398402-65398424 CAGTGTGCAATAAGAAAAGGGGG - Intronic
908569926 1:65398744-65398766 CTGTGTGAACTCAGAAAAGTGGG + Intronic
908705678 1:66951778-66951800 CTGTGAGAAATAAGGAAAGTGGG - Intronic
909153768 1:72043176-72043198 AGGTGTGAACTCAGGAAAGCTGG - Intronic
909500454 1:76329497-76329519 CAGTTTGAGCTAAGGCATGAAGG - Intronic
910335490 1:86124984-86125006 CACCTTGATCTAAGGAAAGAAGG - Exonic
910989032 1:93035915-93035937 GAGTGGGAACTGAGGAAGGATGG + Intergenic
914005692 1:143730591-143730613 CACTGTGAAGTAAGTAAAGTTGG + Intergenic
914098158 1:144561837-144561859 CACTGTGAAGTAAGTAAAGTTGG + Intergenic
914300823 1:146375779-146375801 CACTGTGAAGTAAGTAAAGTTGG - Intergenic
914343135 1:146776938-146776960 CAGTGAGAAATAAGGAGAGTGGG - Intergenic
914517876 1:148389613-148389635 CACTGTGAAGTAAGCAAAGTTGG + Intergenic
914829385 1:151159564-151159586 CCATGTGAACCAAGGAAAGGAGG + Exonic
914987617 1:152473850-152473872 ATATGTGAACTAAGTAAAGAAGG - Intergenic
916948170 1:169750778-169750800 CAGTGTGTTCTAAGACAAGAAGG - Intronic
918511761 1:185320187-185320209 CAGGGTGAATAAAGAAAAGATGG - Intergenic
918535529 1:185570133-185570155 AACTCTAAACTAAGGAAAGATGG - Intergenic
918759120 1:188378394-188378416 GATTGAGAACTAAGGAGAGAGGG - Intergenic
919051193 1:192513410-192513432 CAGTGGGAAGGAAGGAAGGAAGG + Intergenic
919445098 1:197693778-197693800 CAGTGTGGATTATGGAAATATGG - Intronic
919777684 1:201205014-201205036 CAGTGTGACCTAAGGCAGCAAGG - Intronic
920211302 1:204330803-204330825 CAGGGTGATCTAGGGAAGGAGGG - Intronic
920310787 1:205047139-205047161 CAGAGGGGACTAAGGAAGGACGG + Intronic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921893798 1:220378941-220378963 CAGTGGGAACTAGGGAAAATGGG - Intergenic
922217257 1:223530251-223530273 CCTTGTGGACAAAGGAAAGACGG + Intergenic
922233483 1:223705889-223705911 CCGTGTGAACTATGCAAAGTAGG + Intronic
923209389 1:231789317-231789339 CAGGGTGGAGTAAGCAAAGAAGG + Intronic
923940223 1:238814818-238814840 CAGTGTCAATTAGGGCAAGATGG + Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924099096 1:240585211-240585233 TAGTGTGAAGGAAGGAAGGAAGG + Intronic
924288221 1:242510038-242510060 CAATGAGAACGAAGAAAAGATGG - Intronic
1063301918 10:4857152-4857174 CAATGTGAACTAATGAATTATGG - Intergenic
1064961404 10:20968601-20968623 CAGTGAGAACTATGCAAGGACGG + Intronic
1065239561 10:23692590-23692612 CAGTGGGAAATAAGGAAGGAGGG + Intergenic
1065651499 10:27897172-27897194 CAGAGTGAAGTAAAGAAAGAAGG - Intronic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1070322886 10:75367735-75367757 CAGTTTGAACAAAGGAGATAAGG - Intergenic
1070491695 10:76982514-76982536 CAGTTTGAACCAAGGCAAGGTGG + Intronic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1071492280 10:86144018-86144040 CAGTGAGTACTAGGGGAAGAAGG - Intronic
1072286138 10:93917363-93917385 CAGTTTAAAAAAAGGAAAGAGGG - Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1074437194 10:113444254-113444276 CAGTGGGAAAGAAGGACAGAGGG - Intergenic
1074665024 10:115712375-115712397 CAGTGGTATCTAAGGAAAGAAGG + Intronic
1075660789 10:124194215-124194237 CAGTATGAAGAAAGAAAAGATGG + Intergenic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078012921 11:7587510-7587532 CAGTTTGAACTAGGCCAAGAGGG + Intronic
1078644643 11:13129207-13129229 CAGTATTAACTGAGGAAAAATGG + Intergenic
1078942203 11:16020121-16020143 CAATGTGAACACAGGAAAGGAGG - Intronic
1079141859 11:17816262-17816284 TAATGGGAACTGAGGAAAGAGGG - Intronic
1079264533 11:18917933-18917955 CTGTGTGAAATAAGTAAAGGTGG + Intergenic
1079266699 11:18940162-18940184 CTGTGTGAAATAAGTAAAGGTGG + Intergenic
1079883266 11:25953066-25953088 CAGAGTGAAATATGTAAAGAAGG + Intergenic
1080084518 11:28262491-28262513 CACTGTGAAGTAATGAAAGATGG + Intronic
1080753409 11:35171786-35171808 CATTGTTAACTAAAGAAAAATGG + Intronic
1081039237 11:38190379-38190401 CTGTGTGAACTTAGGACTGAGGG + Intergenic
1082927452 11:58564998-58565020 CAGAGTGAACCAAGGACACAGGG + Intronic
1083298787 11:61729405-61729427 CAGTGTGTAATAGGGAAAGGTGG + Intronic
1085350457 11:75795037-75795059 GAGTGAGAAGAAAGGAAAGAAGG - Intronic
1085738634 11:79060984-79061006 CAGTGGGAACTAGAGAAAGATGG + Intronic
1086071490 11:82804469-82804491 CAGTTTGAATTAAGGAAAGTGGG + Intergenic
1086117038 11:83263681-83263703 AAATTGGAACTAAGGAAAGAGGG + Intronic
1086641628 11:89165345-89165367 TAGGGTGAACTAAGGAAATCAGG - Intergenic
1087313934 11:96584191-96584213 CAGTGATAACTGAGGTAAGATGG - Intergenic
1088437849 11:109835028-109835050 CAATCTGAACTAAGGAAAAGGGG + Intergenic
1090964462 11:131585869-131585891 CAGGGAGAAGAAAGGAAAGATGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1092258133 12:6938103-6938125 CAGAGGGAAGGAAGGAAAGAGGG - Intronic
1092819456 12:12339771-12339793 CAGTGAAAAGTAAGGAAGGAAGG - Intronic
1094623826 12:32104777-32104799 GAGTGCGAGATAAGGAAAGATGG + Intergenic
1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG + Intergenic
1096762450 12:53853264-53853286 CAGCCAGAACTATGGAAAGAGGG + Intergenic
1096906517 12:54941684-54941706 CACTGTGAACTTAGCAAAGCAGG - Intergenic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1100613958 12:96216303-96216325 CTGTGTGACCTCAGCAAAGAGGG - Intronic
1100857204 12:98768050-98768072 CAGTGAGAACTTGGGGAAGAGGG - Intronic
1101166774 12:102044882-102044904 CAGGATGAACTCAGAAAAGAAGG - Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103734922 12:123054634-123054656 CAGTTTGAACTCAGGCAAAAAGG - Intronic
1104650353 12:130526953-130526975 GAGCCTGAACTAAGGAGAGAAGG + Intronic
1107269910 13:38603050-38603072 CAGAGTGAAATAAGGAAAGCAGG - Intergenic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1108109039 13:47047519-47047541 CAGTCTGAAAAAAAGAAAGAAGG + Intergenic
1108302525 13:49092610-49092632 CAATGTGAACAAAGGTATGAAGG - Intronic
1108465252 13:50708562-50708584 CAGTGTGAAGAAAGGAGACAGGG + Intronic
1108560478 13:51638318-51638340 GAGTGTGAACTAAGGCAGTACGG + Intronic
1108584891 13:51862649-51862671 CAGTCTGAGCTTAGGAGAGATGG + Intronic
1109035142 13:57248814-57248836 AAGTGTAAACCAAGAAAAGAGGG - Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1110773683 13:79380449-79380471 TAGTATGAACTAAGTAAAGGAGG + Intronic
1111533053 13:89565191-89565213 AAGTGTGAACTAAGAAGAGGTGG - Intergenic
1111997380 13:95178092-95178114 CTGTATGGACAAAGGAAAGAAGG + Intronic
1114444563 14:22778374-22778396 CAGTATGAATTTAGGAAACAAGG + Intronic
1114647591 14:24264187-24264209 TAGTGGGAAGGAAGGAAAGAAGG - Intronic
1115037571 14:28877670-28877692 GAGTGTGAAATAAGGAAATGAGG + Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1116563567 14:46415687-46415709 CACTGAGAACTAGAGAAAGAAGG + Intergenic
1116994068 14:51304023-51304045 CAGTGAGAAGGAAGGAAGGAAGG - Intergenic
1117163335 14:53010266-53010288 CAGTTTGTAATAGGGAAAGATGG + Intergenic
1117918317 14:60701727-60701749 AAGAGTGAAGGAAGGAAAGAGGG - Intergenic
1118710403 14:68514207-68514229 CAGAGAGAACTAAGAAAAAAAGG - Intronic
1119831870 14:77710395-77710417 CAGTGGGAAATAAGGCAGGAAGG + Intronic
1120133076 14:80829943-80829965 CAATGTGAAGGAAGGAAAGAAGG + Intronic
1120186499 14:81398693-81398715 CAGAGTGAAGTAAGGCAAGTTGG - Intronic
1120251642 14:82066275-82066297 CAGAGTGAAAGAAAGAAAGAAGG - Intergenic
1120336717 14:83167019-83167041 AAGTCTGAACTAAGGAAATTGGG + Intergenic
1120625743 14:86823839-86823861 GAGTTTTAACTAAGGCAAGAAGG + Intergenic
1120692979 14:87614016-87614038 GAGTGTGAACAAAAGAAATATGG + Intergenic
1120800091 14:88678237-88678259 CAATGAGAACTAAGGATACAGGG + Intronic
1121632242 14:95429957-95429979 CAGTCAGAACTAAGGAAGGAAGG + Intronic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121896782 14:97656099-97656121 TGTTGTGAACTAAGGAAATATGG + Intergenic
1122292632 14:100687808-100687830 CTGTGTGAACCAGAGAAAGAGGG - Intergenic
1122573991 14:102729813-102729835 TTATGTGAGCTAAGGAAAGATGG + Exonic
1124149042 15:27160269-27160291 CAGACTGACCTAAGGAAAGATGG - Intronic
1124350330 15:28950663-28950685 CAGGGAGGACTATGGAAAGAAGG - Intronic
1124781673 15:32642010-32642032 CAGAGTGGACAAGGGAAAGATGG + Intronic
1125705661 15:41733296-41733318 AAATTGGAACTAAGGAAAGAGGG + Intronic
1126347889 15:47716230-47716252 CTGTGTAACCCAAGGAAAGAAGG - Intronic
1126753077 15:51897189-51897211 CAGTGTAGACTGAGAAAAGAAGG - Intronic
1127799993 15:62469885-62469907 CATTTTGAGCTCAGGAAAGATGG - Intronic
1127938824 15:63671788-63671810 CCTTCTTAACTAAGGAAAGAGGG + Intronic
1129181802 15:73882413-73882435 AAGGGTGAACCAAGGACAGAGGG - Intronic
1129968006 15:79753998-79754020 CAGTCTGTCTTAAGGAAAGAGGG - Intergenic
1130108364 15:80945595-80945617 TTGTGTGAAATAAGGATAGATGG - Intronic
1130246436 15:82254270-82254292 CAGTGGGATCTAAGGAGAGATGG - Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1131491957 15:92870904-92870926 CAGTGACAAATAAGGAAACAAGG + Intergenic
1131516451 15:93080745-93080767 AGGTGTGAAAGAAGGAAAGAGGG - Intronic
1133371811 16:5251031-5251053 TAGTGTGAATAAAAGAAAGAGGG - Intergenic
1133476267 16:6124906-6124928 CACTGTGAAATATGGAAAGCAGG - Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1135663023 16:24312847-24312869 CAGGGTGAAAGAAAGAAAGAAGG + Intronic
1137582058 16:49639583-49639605 CAGTGGGAACAAAGAAAACAAGG - Intronic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1137897965 16:52234559-52234581 CAATGAGAAATAGGGAAAGAGGG + Intergenic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138960176 16:62019714-62019736 CACTTTGAACTTAGGACAGAGGG + Intronic
1139235924 16:65339003-65339025 CACTGTGAACTGTGGTAAGATGG + Intergenic
1139663565 16:68439291-68439313 CAGAGTGAACCAAGGAACGGGGG - Intronic
1139990856 16:70938390-70938412 CAGTGAGAAATAAGGAGAGTGGG + Intronic
1140017414 16:71200942-71200964 CAGTTTGATCAAAGGAAACAGGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140752638 16:78039825-78039847 CAGTGAGAAATAAGGCTAGAGGG - Intronic
1141586450 16:85036783-85036805 GTGTGTGAAATAAGGAAAGGCGG - Intronic
1143054909 17:4155574-4155596 CAGTGTCATCTCAAGAAAGAGGG + Intronic
1144129535 17:12232739-12232761 CAGTATTGACTAAGGAATGAAGG + Intergenic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1148980160 17:51566756-51566778 CAGTGTGGACGAAGGCAGGAAGG + Intergenic
1149237572 17:54610809-54610831 CAATGTGGAGTAAGGAAAGGCGG + Intergenic
1149771848 17:59328705-59328727 CAGTTTGAGCAAAGGACAGATGG + Intergenic
1150431013 17:65117348-65117370 CAGTGTGAAATGAGGAGAAAGGG - Intergenic
1150440179 17:65184837-65184859 CAGTGAGAAGGAAGGAAAGAAGG - Intronic
1151037054 17:70812753-70812775 CAGTGTGTACTAAGGGATGGGGG - Intergenic
1151277880 17:73049558-73049580 CAGTAAGAACTAAGGAACCAAGG + Intronic
1153356047 18:4136427-4136449 CAGTTTTAACTAGGGTAAGATGG + Intronic
1153484082 18:5578037-5578059 CAATCTGTACTAAGCAAAGAGGG + Intronic
1154004176 18:10512670-10512692 CAGGGAGAACTCAGGAGAGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156203996 18:34866027-34866049 CAGTGTGAAGGAACGCAAGATGG - Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1159183481 18:64941621-64941643 AAGTGTGTAGTTAGGAAAGATGG + Intergenic
1159550745 18:69894094-69894116 CAGAGTGAAAGAAGGAAGGAAGG + Intronic
1159633986 18:70783029-70783051 AAGTGAGAAAGAAGGAAAGAAGG - Intergenic
1163319247 19:16563368-16563390 CTGTGTGTAATAAGGACAGAGGG + Intronic
1164048872 19:21567063-21567085 CAATGTGAACTAGGGAAACGAGG + Intergenic
1164406585 19:27953089-27953111 CATTGTTAACTATGGAAAAATGG + Intergenic
1164408198 19:27973398-27973420 CAGTGTACATTAAGGAGAGATGG + Intergenic
1167058460 19:47128350-47128372 CAGGGTGAAGTAATGAAACAGGG + Intronic
1202705816 1_KI270713v1_random:22994-23016 CACTGTGAAGTAAGCAAAGTTGG + Intergenic
925223855 2:2164907-2164929 CACTGTGACAGAAGGAAAGAAGG + Intronic
925290155 2:2742540-2742562 CACTGAGACCTAAGGAAAAATGG + Intergenic
925437268 2:3850279-3850301 CATTGAGAACTAAGCCAAGAGGG - Intergenic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
925878959 2:8334738-8334760 CAGTGTAAACTAACACAAGATGG + Intergenic
926217494 2:10914342-10914364 TAGTGGGAACTAATTAAAGAAGG + Intergenic
926984489 2:18607387-18607409 CAGTGAGAAATAAGGAAAATAGG - Intergenic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928753535 2:34497601-34497623 CAGTGTGAAATAAAGCAGGAGGG + Intergenic
928870015 2:35964798-35964820 TAAGGGGAACTAAGGAAAGAGGG - Intergenic
928922183 2:36537625-36537647 CCGTGTGAACGAATGAAAGAAGG - Intronic
929430296 2:41880609-41880631 CAGAGAGAAATAAGGAGAGAAGG - Intergenic
929743664 2:44632216-44632238 CAGTGAGAAATAATTAAAGAAGG - Intronic
930608260 2:53514547-53514569 TAGTGTGGACTAAAGAAAGATGG - Intergenic
931184604 2:59937922-59937944 AAATGTGAACTAAATAAAGATGG - Intergenic
933147065 2:78866929-78866951 CATTGTTAACCAAGGAAACAGGG + Intergenic
934727226 2:96631099-96631121 TAGTGTGAAGTATGCAAAGATGG + Intronic
940377659 2:152973891-152973913 CAATGTCAACAAAGGAAAAAGGG - Intergenic
940479736 2:154213064-154213086 AAGTATGAACTTAGGAAAAAAGG + Intronic
941235922 2:162973807-162973829 CACTGGGAAGGAAGGAAAGAAGG + Intergenic
941348595 2:164402737-164402759 CAGTGTGAAATAAGCCATGATGG - Intergenic
941944453 2:171079202-171079224 CAGAGTGAAGTATGAAAAGAAGG - Intronic
945436356 2:209822991-209823013 CAGTGTGAATCACAGAAAGAAGG - Intronic
945627682 2:212231421-212231443 CAGTCTGAAGTAATGAAAGATGG - Intronic
945670359 2:212795011-212795033 CAGGGTGAGCTAAGGAAGGGGGG + Intergenic
945813549 2:214576383-214576405 CCCTGTAGACTAAGGAAAGAGGG + Exonic
947956982 2:234200826-234200848 CAGTGTGAAAGAAGGAAATGGGG + Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948372197 2:237496431-237496453 GAGCATGAAATAAGGAAAGACGG - Intronic
948627877 2:239280287-239280309 CTGTGTTAAAGAAGGAAAGAAGG + Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1170176102 20:13471746-13471768 CAGCGTGATCTATGCAAAGACGG + Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171105916 20:22432269-22432291 CAGTGTAATTTATGGAAAGATGG + Intergenic
1171950342 20:31415819-31415841 CAGTGTGAACTGAGGAGTGGTGG + Intergenic
1172038743 20:32029044-32029066 CAGTGGGAGCCATGGAAAGAAGG - Exonic
1172827046 20:37798008-37798030 CAGAGTGAACGCAGGAAGGAGGG - Intronic
1173124954 20:40328112-40328134 CAGTGTGAAGAAAGGAAAAAAGG - Intergenic
1173326519 20:42038488-42038510 CAGAGTGGACTAGGGAAGGAAGG + Intergenic
1173767756 20:45629722-45629744 GAGAGTGAAGGAAGGAAAGAAGG - Exonic
1174375350 20:50123196-50123218 TAGAGTGAGCTAAGGAAAAATGG - Intronic
1174760291 20:53200384-53200406 CACAGTGAACGAAGGAGAGAGGG + Intronic
1175799912 20:61795713-61795735 GAGTGTGGACTCAGGAAGGAGGG + Intronic
1176553242 21:8239295-8239317 CAGTGAAAACCAATGAAAGAGGG - Intergenic
1176572164 21:8422319-8422341 CAGTGAAAACCAATGAAAGAGGG - Intergenic
1176580073 21:8466879-8466901 CAGTGAAAACCAATGAAAGAGGG - Intergenic
1177101606 21:16904010-16904032 TTGTGAGAACTAAGGAAATATGG - Intergenic
1177876303 21:26635878-26635900 ACATGTGAAATAAGGAAAGAAGG - Intergenic
1182133482 22:27877873-27877895 AAGTGTAAACTAAGGAAAAGAGG + Intronic
1184240872 22:43210680-43210702 CAGTGGGAACTGATGAACGATGG + Intronic
1203258240 22_KI270733v1_random:156323-156345 CAGTGAAAACCAATGAAAGAGGG - Intergenic
949191114 3:1250364-1250386 CCCTGTTAACTATGGAAAGAAGG - Intronic
951292397 3:20889261-20889283 GAGTGTTAAATAAGGAAATAAGG + Intergenic
951983800 3:28595501-28595523 CAGTCTGAGGAAAGGAAAGAGGG + Intergenic
953267909 3:41411113-41411135 CAATGTGAACTAGGGGTAGAAGG + Intronic
953872323 3:46637838-46637860 CAGTCAGAACTAACAAAAGAGGG - Intergenic
954174625 3:48834265-48834287 CAGTGTGAACCAAGCAAAGGAGG + Intronic
954526318 3:51274856-51274878 AAATGAGAACAAAGGAAAGATGG + Intronic
955995250 3:64673992-64674014 AAGTGGGAACAAATGAAAGAAGG + Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956262209 3:67356460-67356482 CTGTGTGATCTTAGGAAAGCTGG + Intergenic
956529326 3:70200384-70200406 GAGTGTGAAGTAAGTAAAGTAGG - Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
960629086 3:119710803-119710825 CGGAGTGAACCAAGGTAAGAGGG + Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
963065699 3:141262015-141262037 CAGTTTGAATGATGGAAAGAAGG + Intronic
966044802 3:175534877-175534899 CAGTGTGAACAAAGAAAGAAAGG - Intronic
967836549 3:193969093-193969115 CTGAGTGAACTTAGGAAGGAGGG + Intergenic
968334136 3:197898910-197898932 CAGTAAGAAAAAAGGAAAGAAGG + Intronic
969065665 4:4478584-4478606 CAGGGTGGACAAAAGAAAGATGG + Intronic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
971276857 4:25206548-25206570 CAGTGAGAACAAGAGAAAGATGG - Intronic
971784598 4:31084626-31084648 CAGTGTCACATAAGGAAAGCAGG + Intronic
972954818 4:44376215-44376237 CAGTCTTAACTCAGGAATGAAGG - Intronic
973016284 4:45142821-45142843 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973016298 4:45142884-45142906 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973083186 4:46021299-46021321 CAATGTGAATTAAGGGAAAAAGG - Intergenic
973956722 4:56070118-56070140 CACCGTGAACCAAGCAAAGAAGG - Intergenic
974397482 4:61357555-61357577 CAGTGTAAACTAAAGAAAGCAGG - Intronic
974578540 4:63762422-63762444 CAGTGTGGATAAAGGAAAAAGGG + Intergenic
976190337 4:82480886-82480908 CAGTGTGAGCAACTGAAAGACGG + Intergenic
976608126 4:87001683-87001705 AAGTGTGAAATAAGGATAGGAGG + Intronic
977913663 4:102565859-102565881 CAGTATGAGCTAAGGAGATAGGG + Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
981565719 4:146099358-146099380 CATTTTGAACTAATGAAACATGG + Intergenic
981746234 4:148055058-148055080 CAGTGTGGAATCAGGTAAGAGGG - Intronic
982876462 4:160657390-160657412 CAGTGTGCAATAAGGCAAAAAGG - Intergenic
983655469 4:170079454-170079476 CAGTATGAAAGAATGAAAGAAGG + Intronic
983926201 4:173405443-173405465 CAGAGTGTACTATGGAAAGGGGG - Intronic
984081500 4:175253990-175254012 CAGTGTGTACCAATGAAACAGGG - Intergenic
984105686 4:175542189-175542211 CAGTGTAAACCAAGGAATGTAGG + Intergenic
984201715 4:176729628-176729650 AAGTGTCAGCTAAGGAAAGGAGG - Exonic
985358886 4:189151141-189151163 AAGGGGGAACAAAGGAAAGAAGG - Intergenic
985370985 4:189284884-189284906 CAGTAAGAACTTAGGAAAGGAGG - Intergenic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
987732671 5:21797439-21797461 TAGTGTCAGCTAAGGAAACATGG - Intronic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
988371745 5:30378803-30378825 CAGGATAAAGTAAGGAAAGAGGG + Intergenic
989033103 5:37139911-37139933 AACTGTGTACTAAGCAAAGAAGG - Intronic
989362348 5:40617040-40617062 CAGAGTTATATAAGGAAAGATGG - Intergenic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
991419736 5:66428754-66428776 CAGTGTTAAGTAAAGTAAGAAGG - Intergenic
993862332 5:93151084-93151106 CAGTGTGAACAAAAAAAATAAGG + Intergenic
993862418 5:93152264-93152286 CAGTGTGAACTAAAAAACTAAGG + Intergenic
995123924 5:108561475-108561497 CAGTGACAACTAAGTACAGAGGG + Intergenic
995645496 5:114306662-114306684 AAGTGTGAACTGATGAAAGGTGG - Intergenic
996484555 5:124016766-124016788 CTGTGTGAACTAAGGAACAAAGG + Intergenic
997178909 5:131807772-131807794 CAGTGTTAACTAGGTAAAGCTGG - Intronic
999459402 5:151744977-151744999 CAGTGTGAAATGAGGAAAGTTGG + Intronic
999596571 5:153211612-153211634 GAGTGTGAACTAAGTGAAAAAGG + Intergenic
1000129034 5:158276943-158276965 CAGTGTGAACCAAGGCCTGAAGG + Intergenic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1001285311 5:170418744-170418766 CAGTGTGAACAAAGGCTAGGAGG - Intronic
1002111651 5:176918736-176918758 CTATGTAAACTAAGGCAAGAAGG - Intronic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002530825 5:179843777-179843799 CAGTCTGGAACAAGGAAAGATGG + Intronic
1003006598 6:2388666-2388688 CAGAGTGAACTAAAGAATAATGG - Intergenic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1003817218 6:9855122-9855144 CAATGGGTACTAAGCAAAGATGG + Intronic
1004612621 6:17258972-17258994 GAGTGTCAATTAAGGAAAGCAGG - Intergenic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1007028574 6:38604552-38604574 CATTGTCTACTAAGGAAAGTAGG + Intronic
1007134439 6:39507735-39507757 CAGTGTGATGGAAGGAAGGAAGG - Intronic
1007777994 6:44234447-44234469 CAGTGAAGACAAAGGAAAGATGG - Intergenic
1008107056 6:47450555-47450577 AAGTATGAATTAAGGAAAGAAGG - Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1009296816 6:61961360-61961382 GAGTGTGAAAGAAGGAAAGAAGG + Intronic
1009476156 6:64094868-64094890 AAATGCGAACAAAGGAAAGAAGG - Intronic
1009637281 6:66281820-66281842 CAAAGTGAACTTAGGATAGATGG - Intergenic
1009785495 6:68333110-68333132 ATGAGTGAGCTAAGGAAAGAAGG - Intergenic
1011381574 6:86747533-86747555 CAATATGAACTACGGAAGGATGG - Intergenic
1012766890 6:103378095-103378117 GAGTGTGAATAAAGGAAGGACGG + Intergenic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1016373720 6:143399398-143399420 CAGTGTGTTCTAAGAACAGAGGG + Intergenic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1021958369 7:25849496-25849518 CAGTCTGAAGAAAGGCAAGACGG - Intergenic
1023788887 7:43736412-43736434 CAGCGTGAGATAAGGAAGGAAGG + Intergenic
1026462236 7:70624731-70624753 CAGAATAAACTTAGGAAAGAGGG + Intronic
1027577701 7:79951342-79951364 CAGCGTGAACAAATGCAAGATGG - Intergenic
1028228581 7:88278626-88278648 CATTGTGCAATAAGCAAAGAAGG - Exonic
1028713830 7:93941137-93941159 CAGAGTGAAGAAGGGAAAGAAGG - Intergenic
1028728340 7:94115392-94115414 CAGTGTGTTGTAAGGAAAGATGG + Intergenic
1028988399 7:97025210-97025232 TAGTGGGAAGCAAGGAAAGATGG - Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1030006336 7:105124273-105124295 CAGCGGGAAGGAAGGAAAGAGGG - Intronic
1030486080 7:110169624-110169646 CAGAGTAAATTAAGGGAAGAGGG - Intergenic
1030913719 7:115285543-115285565 CAGAGTGAAGGAAGGGAAGATGG + Intergenic
1031493898 7:122423091-122423113 CAGTCTGTACTATGCAAAGAGGG - Intronic
1031501237 7:122519690-122519712 CAGTGTGACCTAAGGATAGCTGG - Intronic
1032312828 7:130803992-130804014 CAGTGTCAAGGAAGGAAGGAAGG + Intergenic
1032419516 7:131766498-131766520 CAGCGTGAACCCAGGACAGAGGG + Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035383253 7:158453607-158453629 CTGGGTGAGCTCAGGAAAGAGGG + Intronic
1036071957 8:5450602-5450624 GAGTGTCAAATAAGCAAAGAAGG - Intergenic
1037008866 8:13816225-13816247 CAATGAGAATTAAGGCAAGAAGG - Intergenic
1037643824 8:20772315-20772337 CCGTGAGAACTATGGAAAGGAGG + Intergenic
1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG + Intergenic
1041333497 8:56753692-56753714 TGGTGTAAAATAAGGAAAGAGGG - Intergenic
1042334973 8:67620452-67620474 CAGTGTGATTTAGGGAAGGAAGG + Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1042662690 8:71173101-71173123 GAGTGTAAAGGAAGGAAAGAAGG + Intergenic
1043006971 8:74831794-74831816 AGGTGTGAGTTAAGGAAAGAGGG + Intronic
1043449002 8:80348236-80348258 CAGTATGCCCCAAGGAAAGATGG - Intergenic
1047061860 8:121235800-121235822 GAGTGAGAAGGAAGGAAAGAAGG - Intergenic
1049207602 8:141370718-141370740 CAGTGGGAACCAAGGAAACTGGG + Intergenic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1049955468 9:688916-688938 CAGTGGGAAAGAAGGAAAGCAGG - Intronic
1051031088 9:12679597-12679619 CATTGTGAACTAAGGAAGTTGGG + Intergenic
1052444458 9:28542378-28542400 CAGAGAGGCCTAAGGAAAGATGG + Intronic
1052563803 9:30120292-30120314 GACTGTGAAATAAGGAGAGAGGG + Intergenic
1052602391 9:30651769-30651791 CAGTGTAAACTCCAGAAAGAAGG - Intergenic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1055119762 9:72645820-72645842 CATTATTAACTAAGGAAAAATGG - Intronic
1057006171 9:91562171-91562193 CAGTGTCAAAAAAGGAAGGAAGG + Intergenic
1203474434 Un_GL000220v1:138337-138359 CAGTGAAAACCAATGAAAGAGGG - Intergenic
1185492537 X:528790-528812 CAGAGGGAAGGAAGGAAAGAAGG - Intergenic
1186606418 X:11097691-11097713 CACAGTGATCTGAGGAAAGAGGG - Intergenic
1188448639 X:30285296-30285318 CAGTCTGAGCTAAGAAAAGTAGG + Intergenic
1188523443 X:31063209-31063231 AAGTGAGAAACAAGGAAAGAGGG - Intergenic
1189993158 X:46613400-46613422 AAATGTGAATTAAGGAAAAATGG + Intronic
1190262834 X:48808475-48808497 CAGAGTGAAATTAGGAGAGATGG - Intronic
1190757309 X:53412279-53412301 CAGTGAGAACTATGGAAGAAGGG + Intronic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192680882 X:73252895-73252917 CAGGTTGAACTAAGGTAAGAGGG + Intergenic
1193901892 X:87189755-87189777 CAGGGTGAAACAAGGAAAGTTGG + Intergenic
1195199722 X:102536040-102536062 AAATGGGAACAAAGGAAAGAAGG + Intergenic
1195612097 X:106879062-106879084 CAGCGTGAACTAAGAAATTAAGG + Intronic
1196002203 X:110797441-110797463 CACTGTTAACAAAGGAAAGGGGG + Intergenic
1197250956 X:124216092-124216114 CAGTGAGTACAAAGGAAAAAGGG - Intronic
1198599826 X:138270343-138270365 CAGTGAGAACGGAGGAAAGTAGG - Intergenic
1199412933 X:147546069-147546091 CACTGTGAACCAAAGAAAGAGGG + Intergenic