ID: 924027224

View in Genome Browser
Species Human (GRCh38)
Location 1:239847045-239847067
Sequence GGACAGAGTAGAACACCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924027224_924027229 23 Left 924027224 1:239847045-239847067 CCTTCTGGTGTTCTACTCTGTCC 0: 1
1: 1
2: 1
3: 15
4: 185
Right 924027229 1:239847091-239847113 TTATCATCTAATATGGCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 135
924027224_924027228 16 Left 924027224 1:239847045-239847067 CCTTCTGGTGTTCTACTCTGTCC 0: 1
1: 1
2: 1
3: 15
4: 185
Right 924027228 1:239847084-239847106 CACATTGTTATCATCTAATATGG 0: 1
1: 0
2: 0
3: 13
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924027224 Original CRISPR GGACAGAGTAGAACACCAGA AGG (reversed) Intronic
901005984 1:6171718-6171740 GGACAGAGCAGAGGCCCAGAGGG + Intronic
902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG + Intronic
903332615 1:22603703-22603725 AGACAGATGAGAAAACCAGAGGG - Intergenic
904272079 1:29356727-29356749 GGTCAGAGTCAAACTCCAGAAGG + Intergenic
904339427 1:29824608-29824630 GGACAGGGAAGATCAGCAGAGGG + Intergenic
904880820 1:33695499-33695521 GGAAGGAGGAGAACACCAGCAGG - Intronic
905916486 1:41688205-41688227 GGTCAGAGGAGAACAACAGAAGG - Intronic
905916491 1:41688228-41688250 GGCCAGAGGAGAGCAACAGAAGG - Intronic
907031556 1:51177258-51177280 AGGTAGAGTAGAACCCCAGAAGG + Intergenic
908653980 1:66368412-66368434 GGAAAGAGGAGAACAGCTGATGG - Intronic
908867302 1:68563549-68563571 GCACATACTAGAACACCTGAAGG - Intergenic
911447859 1:98021306-98021328 GGGAAGAGTACCACACCAGATGG - Intergenic
911782581 1:101901314-101901336 GGACAAAGTAGAATTTCAGATGG + Intronic
911785265 1:101938478-101938500 GCACAAGGTAGAACATCAGAAGG - Intronic
912683865 1:111746793-111746815 GGAGACAGTAGATCACCAGAGGG + Intronic
914877859 1:151525611-151525633 GGGGAGAGTTGGACACCAGAAGG - Intronic
918053209 1:180993138-180993160 GCCCAGAGAAGAAGACCAGAGGG + Intronic
920150382 1:203901234-203901256 GAACACATTGGAACACCAGAAGG + Intergenic
920212162 1:204336041-204336063 GGAGACAGAAGAAGACCAGATGG - Intronic
921310342 1:213836190-213836212 GGACACAGAACAAGACCAGAAGG + Intergenic
921595719 1:217051733-217051755 GGGCAGAATAGGACTCCAGATGG - Intronic
924027224 1:239847045-239847067 GGACAGAGTAGAACACCAGAAGG - Intronic
1063399403 10:5727847-5727869 GGATACAGTAGAATACAAGAAGG - Intronic
1069562618 10:69441495-69441517 GGACACAGTAGAACTCTAGCAGG + Intergenic
1071115499 10:82214368-82214390 GGACAGACTGGAACACCTGCTGG - Intronic
1079913251 11:26337004-26337026 GGACAGAGTAGAAGACCAGATGG - Intronic
1080268128 11:30422822-30422844 GGAGAGATTAGAAAACTAGAAGG + Intronic
1080479990 11:32637761-32637783 GGAAAGAGTGGAACACTTGAAGG - Intronic
1081778052 11:45690220-45690242 AGACAGAGGAGAACAAAAGAAGG - Intergenic
1083088252 11:60172864-60172886 AGACAGAGAAGAAAAGCAGATGG - Exonic
1083145541 11:60755670-60755692 GCTCAGAGTGGATCACCAGAGGG - Intergenic
1083932669 11:65854483-65854505 GGACAGAACAGAATATCAGATGG + Intronic
1085024563 11:73229074-73229096 GGACAGAGAAAAGCATCAGATGG + Intronic
1085412804 11:76301564-76301586 GGGCAGTGTGGAACACCAGTAGG + Intergenic
1086401247 11:86462788-86462810 TGACAGAGGGGAACACCTGAGGG + Intronic
1087327794 11:96744587-96744609 GGACAGATTATAAGACCAAAAGG - Intergenic
1087474117 11:98616219-98616241 GAAGAAAGAAGAACACCAGATGG + Intergenic
1090575412 11:128096770-128096792 GGACTGAATAGAACAAAAGAGGG + Intergenic
1090832203 11:130427734-130427756 GGAGAGAGGAGACCACCAGGAGG - Exonic
1091964127 12:4723589-4723611 GGAAAGAGGAGTAAACCAGATGG - Intronic
1097275421 12:57810226-57810248 GGACTAAGAAGAAAACCAGATGG + Intronic
1097905839 12:64918963-64918985 GCACAGAGGAGAGCACCAGCTGG + Intergenic
1098213650 12:68193110-68193132 GGACAGCTTAGAACACAATAGGG - Intergenic
1098851330 12:75600012-75600034 GGACAGAGTAGAACTGGAGTGGG - Intergenic
1100692508 12:97053695-97053717 GGCCAGAGATGAACACCAGGTGG + Intergenic
1101171154 12:102095854-102095876 TGACACTGTAGAACTCCAGATGG + Intronic
1102777271 12:115531486-115531508 AGACAGAACAGATCACCAGAAGG + Intergenic
1102838223 12:116088079-116088101 GGAAAGAGTTTACCACCAGAAGG + Intronic
1103608610 12:122107054-122107076 AGACAGAGGAGAACACAAGGAGG - Intronic
1107349559 13:39499942-39499964 GGACAAAATAGCACAACAGAAGG - Intronic
1108698339 13:52922702-52922724 GGACAGAGCAGAGCAGCACAAGG - Intergenic
1113303501 13:109049893-109049915 GGAAAGAGGAGAACAAAAGATGG - Intronic
1114203638 14:20547172-20547194 GGAGGGGGCAGAACACCAGAGGG + Intergenic
1116130503 14:40850436-40850458 GGAGAAAGAAGAAAACCAGAAGG - Intergenic
1117653116 14:57926905-57926927 GGACAGAAAAGGAGACCAGAGGG - Intronic
1122272891 14:100576254-100576276 GGACAGAGCAGGCCACCTGAGGG + Intronic
1123071986 14:105646517-105646539 GGACAGAGGAGAGCATCAGAAGG - Intergenic
1132192961 15:99884783-99884805 TGACAGAGTAGAACTACTGATGG - Intergenic
1136864898 16:33739872-33739894 GCACAGAGTAGAACACTAAATGG + Intergenic
1137833270 16:51565100-51565122 GGACGGAGGAGAACCCAAGATGG + Intergenic
1138167036 16:54812425-54812447 GGTCAGCGTAGAACAGGAGATGG - Intergenic
1141097075 16:81170534-81170556 GGTCAGAGAAGACCCCCAGAAGG + Intergenic
1203126396 16_KI270728v1_random:1588012-1588034 GCACAGAGTAGAACACTAAATGG + Intergenic
1146625189 17:34430057-34430079 GGACAGAGTAGAAACTCGGACGG + Intergenic
1148505482 17:48123782-48123804 GGACAGAGCAAAACAGAAGAGGG - Intergenic
1149300117 17:55297624-55297646 GGACAGAGGAACACAGCAGAGGG - Intronic
1152215246 17:79028107-79028129 AGACAGAGTAGAGCAGGAGACGG + Intronic
1153931330 18:9882300-9882322 GAACAAAGAAGGACACCAGAAGG - Intergenic
1154215344 18:12411767-12411789 AGACACAGTGGAACACCAGTGGG - Intronic
1155699124 18:28721536-28721558 GGACACTGTAGAACAGGAGAAGG - Intergenic
1156101864 18:33606081-33606103 GGAAAGAGTAGAAGAGCACAGGG - Intronic
1156126841 18:33915999-33916021 GTACAGAGTAGCACAGCAGTGGG + Intronic
1157638742 18:49189761-49189783 GGAGAGACTAGAAAACTAGATGG + Intronic
1158697087 18:59713265-59713287 GAACACATTTGAACACCAGAAGG - Intergenic
1159668503 18:71194063-71194085 AGAAAGAGTAGAACAGAAGAAGG + Intergenic
1160829007 19:1094171-1094193 GGACAGAGGTGAACAGCAAACGG + Intronic
1161905854 19:7156025-7156047 GGGCAGAGTAGAATGCCATATGG + Intronic
1162194418 19:8973270-8973292 GGACACAGTTGAAAACAAGATGG + Exonic
1162880118 19:13652527-13652549 GGCCTGAGTAGAACAAAAGATGG - Intergenic
1164949162 19:32321902-32321924 CGGCAGAGCAGAACAGCAGACGG - Intergenic
1165382386 19:35490382-35490404 GGGCAGAGTGGAGCACCAGGAGG + Exonic
1165929857 19:39350431-39350453 GGCCAGAGAAGAAGCCCAGAGGG + Intronic
1167016251 19:46842865-46842887 AGACCGAGGAGAGCACCAGAGGG - Intronic
1167277435 19:48546799-48546821 GGACAGAGGAACTCACCAGATGG - Intergenic
925442424 2:3899964-3899986 GGAAATATTAGAAAACCAGAGGG - Intergenic
926391345 2:12396613-12396635 GAGCAGAGCAGAAGACCAGAAGG - Intergenic
926605406 2:14893580-14893602 GCACAGAGTAGAACAGAAAAAGG - Intergenic
927187853 2:20495062-20495084 GGTCAGACTAGAGCCCCAGAAGG - Intergenic
927335495 2:21918384-21918406 GGACAGAGAATAAAACCAGTGGG + Intergenic
927540312 2:23904172-23904194 GTACAGAGTATAAAAACAGAAGG + Intronic
929011277 2:37447558-37447580 GTACAGAGGAGAGAACCAGAGGG + Intergenic
929340238 2:40806689-40806711 GTACACTGTAGAACAACAGAGGG - Intergenic
929953304 2:46434221-46434243 TGACAGTGTAGAACAACAGGAGG + Intronic
930417717 2:51109884-51109906 GGGCATAGTAATACACCAGAGGG + Intergenic
933518083 2:83331481-83331503 GGACAGAGCAGAACAAAAGCTGG - Intergenic
934495366 2:94791680-94791702 GGACAGAGTAGAACTCCGCAGGG - Intergenic
934633418 2:95956696-95956718 GCACAGAGGAGAACACTAAACGG + Intronic
934800084 2:97146584-97146606 GCACAGAGGAGAACACTAAATGG - Intronic
937209300 2:120258074-120258096 CTACAGAGTAGAAAAACAGAGGG - Intronic
937722274 2:125115302-125115324 TGACAGAATAGGACACTAGACGG + Intergenic
939115141 2:138052167-138052189 AGACCGAGTAGAACACAAAAAGG - Intergenic
939410292 2:141815910-141815932 GGACACAGTAGAACAGTAAAGGG + Intronic
940120042 2:150254218-150254240 GCATAGAATAGATCACCAGAAGG - Intergenic
940422431 2:153496075-153496097 GGACAGAGTGGAACCAAAGAAGG + Intergenic
941839270 2:170062228-170062250 TGACAGGGTAGGAAACCAGAAGG + Intronic
943922151 2:193722850-193722872 GGATAGAGTACAACACATGAGGG + Intergenic
943947719 2:194089719-194089741 GGACACAGCTGAACATCAGAAGG - Intergenic
947806068 2:232968943-232968965 TGACAGAGTAGAAAGCTAGAAGG + Intronic
948521239 2:238539590-238539612 GGAGAGAGTACAACTCCAGGAGG - Intergenic
1171295863 20:24016402-24016424 GCACAGAATCAAACACCAGAAGG - Intergenic
1173413840 20:42838627-42838649 GGACAGAGGAGAGGATCAGAAGG + Intronic
1174437501 20:50520935-50520957 GGTCACAGGAGAAGACCAGAGGG + Intronic
1177512804 21:22112011-22112033 GTACAAAGTAGAATACCAAAGGG + Intergenic
1181637933 22:24182888-24182910 GGACACAGTAGAAAGCCACAGGG - Intronic
1182735339 22:32529099-32529121 GGACAGAAGTGACCACCAGATGG + Intronic
1183678427 22:39312745-39312767 GGACAGAGTGGGAGGCCAGAAGG + Intergenic
1183970356 22:41472813-41472835 TGACTGAGTAGTACACAAGAGGG + Intronic
1184321709 22:43746918-43746940 GGACAGAGCTGCACACCAGCAGG + Intronic
950328830 3:12139403-12139425 GGAGAGAATAGATCACCAGGGGG + Intronic
952852708 3:37741993-37742015 GGACAGAGGAGAAAACAAGGAGG - Intronic
952872842 3:37917202-37917224 GGACAGAGACAAACACAAGAGGG + Intronic
955468285 3:59258858-59258880 AGACAGAGTTGAAAACCAGCTGG - Intergenic
955896834 3:63709253-63709275 GGACAGAGGAAAAGACCTGAGGG - Intergenic
956754549 3:72372302-72372324 TAACAGAGTAGAACACCACATGG - Exonic
957524617 3:81363752-81363774 GGAAAGACTAGAATCCCAGAAGG + Intergenic
959287053 3:104428147-104428169 GGACAGAGTTGAACTACAAATGG + Intergenic
959456283 3:106566500-106566522 GGACCTGGTAGAACACCAGGAGG - Intergenic
964034892 3:152183642-152183664 CAGCAGAGTAGACCACCAGATGG + Intergenic
969227403 4:5807904-5807926 GGACAGAGTAGAAAAGCTGGGGG - Intronic
969440148 4:7212176-7212198 GAAGAGAGGAGAACCCCAGAGGG - Intronic
970054268 4:11952796-11952818 GTAAGGAGTAGAACAGCAGAGGG + Intergenic
970106812 4:12594954-12594976 GAAAAGAGTAGAACCCCAGGTGG - Intergenic
970117930 4:12720231-12720253 GGACAAGGTAGAGCAGCAGAGGG + Intergenic
971496652 4:27273915-27273937 GGAGAGAGGAGAACCCAAGATGG + Intergenic
972974081 4:44612145-44612167 GGAAAGAGCAGAACACAATAAGG + Intergenic
975072564 4:70159921-70159943 GGACAGAATAGAACAACAATTGG - Intronic
975269337 4:72411504-72411526 TGACAGAGTAGAAGGCAAGAAGG + Intronic
975446179 4:74468100-74468122 GGATACAGATGAACACCAGACGG - Intergenic
980728986 4:136803247-136803269 GGAGAGAGAGGAACAACAGACGG - Intergenic
986501894 5:8409520-8409542 GGACAGAGGTGAACACCGGTTGG - Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
989383273 5:40830134-40830156 GGACAGAGTTGAAAAGCAGATGG + Exonic
991137567 5:63199980-63200002 GGACAGAGAAGAAAAGTAGAAGG - Intergenic
991234781 5:64380858-64380880 GGGCAGAGAAGATCACAAGAAGG + Intergenic
991562076 5:67964407-67964429 GAACAGAGTAAAACACCTTATGG - Intergenic
993466197 5:88249888-88249910 GGACACAGAAGAAGACAAGAGGG + Intronic
994071955 5:95612803-95612825 GGGCAGAGCAGAAGACCTGATGG + Intergenic
994141336 5:96344984-96345006 AGCCAGAGTAGAGCAGCAGAAGG - Intergenic
994650437 5:102520252-102520274 GGACAGAATAGAAAGACAGAGGG + Intergenic
995550488 5:113276265-113276287 GGCCTGGGTAGAACAACAGATGG + Intronic
999996854 5:157100488-157100510 GGACAGAGCAGGAAACAAGAGGG + Intronic
1000631607 5:163596765-163596787 AGAAAGAGCAGAACACCATATGG - Intergenic
1001648742 5:173300745-173300767 GGGTAGAGTAGAAAGCCAGAGGG - Intergenic
1001689686 5:173623834-173623856 GGGGAGAGGAGAACAGCAGATGG + Intergenic
1005971781 6:30767425-30767447 GGACAGAGTACAAAACCATATGG + Intergenic
1007071323 6:39040433-39040455 GGTCAGACCAGAACAACAGAGGG + Intergenic
1007215293 6:40232701-40232723 TGAAAGAGAAGAACCCCAGAGGG + Intergenic
1008433406 6:51446751-51446773 GTACAGAGGACAACAGCAGAAGG + Intergenic
1010780237 6:79937252-79937274 GGACAGAGTTAAAAAGCAGAGGG + Intronic
1011338201 6:86284109-86284131 GAACATATTAGAACATCAGAAGG - Intergenic
1011787446 6:90862720-90862742 GGACAAAGGAGGAAACCAGATGG - Intergenic
1014799176 6:125759008-125759030 GGACAGAGTGGAACATCAGTGGG + Intronic
1017978098 6:159375464-159375486 GGAAAGAATAGAATACCAAAAGG - Intergenic
1018908925 6:168090834-168090856 GGACAGAGTAGCCCCCAAGAGGG - Intergenic
1019440493 7:1043815-1043837 GGGCCGAGTGGAACACCAGCAGG - Intronic
1020705373 7:11537510-11537532 TGACAGAGTGGAGCAACAGAGGG - Intronic
1021812175 7:24413510-24413532 GGAAAAAGCATAACACCAGAAGG + Intergenic
1021986158 7:26100452-26100474 GGGCAGAGTAGAAAACAAAAGGG - Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025002775 7:55331247-55331269 GCACAGAGCAGAAAAACAGAGGG + Intergenic
1028958573 7:96722637-96722659 CCAAAGAGTAGATCACCAGATGG - Intergenic
1029460280 7:100690332-100690354 GGAGAGAGTAGAACAGAAAAGGG + Intergenic
1030183562 7:106736701-106736723 AGACACAGTCAAACACCAGAGGG - Intergenic
1031469174 7:122148357-122148379 GGACAGTGGAGAACATCATAGGG + Intergenic
1033535435 7:142307964-142307986 GGACAGATAAGAACATCACAGGG + Intergenic
1033610528 7:142960071-142960093 GGACTGAGAGGAAAACCAGAAGG - Intronic
1035396411 7:158538066-158538088 GGAAGGAGTAGACCACCACAGGG + Intronic
1037632954 8:20674854-20674876 GGACAGCAGAGAACAACAGATGG + Intergenic
1039852355 8:41380157-41380179 AGAAAGAGTAGAAGATCAGAAGG + Intergenic
1043734203 8:83723992-83724014 GGTGAGAGCTGAACACCAGATGG - Intergenic
1045204354 8:100022374-100022396 GGACAGAGTAAAAAATCAGAAGG + Intronic
1045756929 8:105554850-105554872 GAACATAGTAGCACACCAAAGGG - Intronic
1045935399 8:107672728-107672750 GGACAGTGTAAGACACCAGCTGG - Intergenic
1046634029 8:116652097-116652119 GGACAGAGATGAGCACAAGAGGG + Intronic
1048205010 8:132408409-132408431 GTAGAGAGTCGAACACCAGCTGG - Intronic
1050384837 9:5077925-5077947 TGACAGAGAAGAATACCAGGGGG + Intronic
1051691930 9:19723583-19723605 GGATCGAGTATAACACTAGAAGG + Intronic
1052717666 9:32136809-32136831 GGAGAGAGTAGGAGACAAGACGG - Intergenic
1052876549 9:33571764-33571786 GGACAGAGTAGAACTCCGCAGGG + Intronic
1055709010 9:79038140-79038162 AGTCAGAGTAGACCACCAGATGG + Intergenic
1057118352 9:92546606-92546628 GAACACACTGGAACACCAGAAGG + Intronic
1057678872 9:97157117-97157139 GGACAGAGTAGAACTCCACAGGG - Intergenic
1058132634 9:101270023-101270045 GCACACAATAGAGCACCAGAGGG - Exonic
1058184273 9:101835915-101835937 GGACAAAGTAGCAGAGCAGATGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1186629758 X:11335942-11335964 GGACAAAGTAGAAGGCAAGAAGG + Intronic
1191992913 X:67058607-67058629 TGACAGAGTATAACACCAAAGGG - Intergenic
1193191386 X:78574813-78574835 GAAGAGAGTAGAGCACCACAAGG - Intergenic
1193419256 X:81263970-81263992 GAACTGAGTAGAACACCACGAGG - Intronic
1195392925 X:104381832-104381854 GGAGAAAGTATAACAACAGATGG - Intergenic
1195719814 X:107856234-107856256 TGACAGAGTGGAACATTAGAGGG - Intronic
1200561564 Y:4709777-4709799 GGAAAGACCAGAAGACCAGAAGG + Intergenic
1202586961 Y:26440868-26440890 GCACAGAGTAGAACACTAAATGG - Intergenic