ID: 924027586

View in Genome Browser
Species Human (GRCh38)
Location 1:239851582-239851604
Sequence GTGGGTGTTTAATACATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 5, 3: 12, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924027586_924027593 25 Left 924027586 1:239851582-239851604 CCTGAAATGTATTAAACACCCAC 0: 1
1: 0
2: 5
3: 12
4: 166
Right 924027593 1:239851630-239851652 AGCAACATCTGACACCTTCTTGG 0: 1
1: 0
2: 0
3: 29
4: 195
924027586_924027587 -7 Left 924027586 1:239851582-239851604 CCTGAAATGTATTAAACACCCAC 0: 1
1: 0
2: 5
3: 12
4: 166
Right 924027587 1:239851598-239851620 CACCCACAGCCCTTTTCAAATGG 0: 1
1: 0
2: 1
3: 13
4: 180
924027586_924027594 26 Left 924027586 1:239851582-239851604 CCTGAAATGTATTAAACACCCAC 0: 1
1: 0
2: 5
3: 12
4: 166
Right 924027594 1:239851631-239851653 GCAACATCTGACACCTTCTTGGG 0: 1
1: 0
2: 1
3: 10
4: 136
924027586_924027588 -6 Left 924027586 1:239851582-239851604 CCTGAAATGTATTAAACACCCAC 0: 1
1: 0
2: 5
3: 12
4: 166
Right 924027588 1:239851599-239851621 ACCCACAGCCCTTTTCAAATGGG 0: 1
1: 0
2: 1
3: 7
4: 156
924027586_924027595 27 Left 924027586 1:239851582-239851604 CCTGAAATGTATTAAACACCCAC 0: 1
1: 0
2: 5
3: 12
4: 166
Right 924027595 1:239851632-239851654 CAACATCTGACACCTTCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924027586 Original CRISPR GTGGGTGTTTAATACATTTC AGG (reversed) Intronic
901805992 1:11738882-11738904 GTAGGAGTTTATTCCATTTCTGG + Intronic
902827580 1:18987597-18987619 GTGGTTGTTTCAGGCATTTCAGG + Intergenic
905624843 1:39482574-39482596 ATGGATGTTTAAAACATTTAAGG + Intronic
909113833 1:71509700-71509722 GTGGGTGCCTAATAAATTTAAGG + Intronic
909906737 1:81205797-81205819 GTGTGTGTTTTATATATTACTGG + Intergenic
910156795 1:84228546-84228568 GTGGGTACTGAATACATTTGAGG - Intronic
912129632 1:106585817-106585839 GTTGGTGATTGATGCATTTCTGG - Intergenic
912465990 1:109874304-109874326 GTCAGTGTTTAATAAATTTTGGG - Intergenic
913355269 1:117914083-117914105 ATGGGTGTCTAAGTCATTTCAGG - Intronic
915802705 1:158810887-158810909 GTGCATGTTTAATACATGTGCGG + Intergenic
916837058 1:168556503-168556525 TTGAGTGTTTAATACATGCCAGG + Intergenic
916862218 1:168818144-168818166 GTTGGTATTTACTACATTGCAGG - Intergenic
917881642 1:179342960-179342982 TTTGGTGTTTACCACATTTCTGG - Intronic
918839093 1:189511523-189511545 TTTGGTGTTTCATGCATTTCTGG + Intergenic
919250131 1:195044394-195044416 GTGGATTTTTAATACTTTTTAGG - Intergenic
921103526 1:211952506-211952528 GTGGGTTTTTCATACATTTATGG - Intronic
921641606 1:217561476-217561498 GTGTGTATTTAATGCATTTTAGG + Intronic
922062400 1:222104942-222104964 GTTGGTGATAAATCCATTTCAGG + Intergenic
923662542 1:235970941-235970963 GTGTGTGTTTACAACATTTCTGG + Intergenic
924027586 1:239851582-239851604 GTGGGTGTTTAATACATTTCAGG - Intronic
924794195 1:247280729-247280751 GGGGGTGTTTAATAATATTCTGG - Intergenic
1066261021 10:33729758-33729780 GTTGGTTTCAAATACATTTCAGG - Intergenic
1069172555 10:65252135-65252157 GTTGGTGTTTCTTACATTTTAGG - Intergenic
1069258889 10:66369104-66369126 CTGGGTTACTAATACATTTCAGG + Intronic
1069969683 10:72155909-72155931 ATGGGTGTTCAATAAATCTCTGG + Intronic
1070308015 10:75251333-75251355 GTGGGGGTTTAAAGCATGTCAGG + Intergenic
1074919071 10:117988791-117988813 GTGTGTGTATTATACATTTGGGG + Intergenic
1075292781 10:121244537-121244559 GTGTGTGTTTAAAACAAATCAGG - Intergenic
1075306350 10:121370967-121370989 GCTGGTGTTGACTACATTTCAGG - Intergenic
1076304634 10:129456302-129456324 GTGCGTGTTTAACACCTTTGTGG + Intergenic
1077553180 11:3212823-3212845 GTAGGTGTGTTATACATTTCAGG - Intergenic
1078320550 11:10330860-10330882 GTGGGTGTTTAATATACATTAGG - Intronic
1082957592 11:58886731-58886753 GTGTGTGTTTTATGCATATCTGG + Intronic
1083002514 11:59308059-59308081 TTGGGTGTTTAATGCTTTTATGG - Intergenic
1087491006 11:98827259-98827281 GTGCGTGTGTAATTCTTTTCAGG + Intergenic
1089312708 11:117570566-117570588 GTAGGTGCTGAATACATTTTTGG + Intronic
1089630963 11:119783853-119783875 GAGGGTGTTTAATCCTTTTGCGG + Intergenic
1094386482 12:29899945-29899967 GTAGGTGTTCAATAGATTCCAGG + Intergenic
1095826339 12:46533705-46533727 GTCAGTGTTTTATTCATTTCAGG + Intergenic
1097214210 12:57397285-57397307 CTGGCTGTTTAATCTATTTCAGG + Intronic
1098169121 12:67728394-67728416 ATGGATGTTTAATATATTCCAGG + Intergenic
1098238838 12:68444970-68444992 TTAGGTGTTTAATTCATTTAGGG - Intergenic
1098708462 12:73722378-73722400 GTTGGTGTATAGTACAGTTCTGG - Intergenic
1098999937 12:77167678-77167700 GTGACTGTTTCATACATCTCAGG + Intergenic
1100809287 12:98322742-98322764 ATGTGTGTTCAGTACATTTCAGG + Intergenic
1101776805 12:107802864-107802886 GTGGTTGTTAATTACATTTGTGG - Intergenic
1103259512 12:119574309-119574331 GTGGGTGTTTACTACATGCCAGG + Intergenic
1105037170 12:132934082-132934104 GTGTGTGTTTAATAGAGTTGGGG - Intronic
1107156499 13:37173170-37173192 GTAGGCTTTTAATTCATTTCTGG + Intergenic
1107811472 13:44204595-44204617 CTGGGTGATTTATACATTGCTGG - Intergenic
1108416680 13:50204723-50204745 CTGGGTGTTTAAATGATTTCTGG - Intronic
1111078301 13:83267856-83267878 GTGTATGGTTTATACATTTCAGG + Intergenic
1112587808 13:100735514-100735536 GTGGGTCTTTAAGGCATATCTGG + Intergenic
1112831225 13:103454501-103454523 GTGTGTTTTTAATACATTTTGGG - Intergenic
1113181595 13:107634659-107634681 GTGGGTTTTTTCCACATTTCAGG + Intronic
1113294770 13:108946971-108946993 GAGGTTGCTTAATACATTTGTGG + Intronic
1117239004 14:53809378-53809400 GTTGGTGTTTAATACATGCTGGG + Intergenic
1125853583 15:42927412-42927434 GTAGGTGCTTAATACATTTCTGG - Intergenic
1127118309 15:55748820-55748842 CTGAGTGTTTAATACATATAGGG - Intergenic
1128502389 15:68235907-68235929 TTCTGTGTTTAATACATTCCTGG - Intronic
1128878137 15:71218891-71218913 GTAGATGTTTAATAAATATCTGG - Intronic
1130063411 15:80585674-80585696 GTGGGTGTGTAGACCATTTCTGG - Intronic
1138340476 16:56285915-56285937 GTGGATGTATAATCCCTTTCTGG + Intronic
1138700258 16:58855287-58855309 ACAGGTGTTTAATACATTTTTGG + Intergenic
1138868666 16:60853040-60853062 GTTGGGGATTGATACATTTCCGG + Intergenic
1139660372 16:68416701-68416723 GTGAGTGTTTAATAGTTTCCAGG + Intronic
1139680598 16:68558923-68558945 GTGGGTGTTTCCTACAAGTCTGG - Intronic
1142748830 17:1975230-1975252 GTGGGTGTTTGGGACATTTTAGG - Intronic
1146507745 17:33420185-33420207 ATGGGTGTTCAATAAATATCTGG - Intronic
1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG + Intronic
1147895184 17:43745962-43745984 GTGGGTGTTTAATAATGTCCAGG + Intergenic
1148873167 17:50670455-50670477 GTGGGTGCTTAATAAATATATGG - Intronic
1150587329 17:66530892-66530914 GTGGCTGTTTAATCCATACCAGG - Intronic
1152227009 17:79097329-79097351 GGCCGTGTATAATACATTTCGGG - Exonic
1155051366 18:22150700-22150722 GTTGGTGTTTAATAAATTCATGG + Intergenic
1155202072 18:23526143-23526165 GTGGGTGATCAGTACATTTATGG + Intronic
1155378256 18:25186356-25186378 ATTGGTGATTAATATATTTCAGG - Intronic
1155526342 18:26719853-26719875 GTAGGTGTTCAATACATGTTAGG + Intergenic
1155864795 18:30951961-30951983 GGGGTTGTTGAATACATTCCAGG - Intergenic
1156202957 18:34855059-34855081 GTGAGTTTTTAGGACATTTCAGG + Intronic
1162057046 19:8071123-8071145 GCAGGTGTTTAATACATTTTTGG + Intronic
1163801273 19:19367274-19367296 GTAGGTGCTTAATACATGTTTGG - Intergenic
1164698382 19:30263722-30263744 GTGTGTATTTCATACATTTATGG + Intronic
1164968937 19:32513668-32513690 GTGGGTTTTTCATAAATGTCTGG + Intergenic
1166593211 19:44020228-44020250 TAGGGTGTTTAATTCATTTATGG - Intergenic
925505606 2:4559817-4559839 GTGTGTGTGTAATACATCTTAGG - Intergenic
926895263 2:17679952-17679974 GTGGGAATTTAATGCAGTTCAGG - Intronic
927482275 2:23463886-23463908 GTGATTGTTAAACACATTTCAGG - Intronic
928030912 2:27778374-27778396 TTGGGTGATTATTCCATTTCTGG + Intronic
928225332 2:29443513-29443535 TTGTTTGTTTAATACAATTCTGG + Intronic
931827223 2:66014272-66014294 TTTGTTGTTTCATACATTTCTGG + Intergenic
933257942 2:80102014-80102036 GTGGTTATTTTATTCATTTCTGG + Intronic
941427139 2:165362076-165362098 GTTTGTGTTTAATAAATTTTGGG - Intronic
942142199 2:172988636-172988658 GTGGGTGTTTGCTCTATTTCAGG + Intronic
946539146 2:220664654-220664676 GGGGGCGTTAAATACATGTCAGG - Intergenic
1169882034 20:10357344-10357366 CTGGTTGTTTGATAAATTTCTGG - Intergenic
1170049066 20:12121166-12121188 GTGTGTGTGTAAAACATTTAAGG + Intergenic
1170532497 20:17308687-17308709 GTGGGTGTCTCATACATCTATGG + Intronic
1171049392 20:21841067-21841089 GTGGGGGTTAAATGCCTTTCAGG + Intergenic
1172261381 20:33568853-33568875 CTGGGGGTCTAATAGATTTCAGG - Intronic
1173559163 20:43990337-43990359 GTGGATGCTTACTACATTTTAGG + Intronic
1179825390 21:43962532-43962554 CTGGCTTTTTAATGCATTTCTGG + Intronic
1180919799 22:19515866-19515888 GTGGATGTTCAATACATGTCTGG - Intronic
956681080 3:71781592-71781614 CTGTTTGTTTATTACATTTCAGG - Exonic
957401985 3:79727529-79727551 GTGGGTATTTAATAAATATGTGG - Intronic
959543170 3:107563804-107563826 CTGAGTGTTTAATACATGTCAGG - Intronic
961072742 3:123950486-123950508 CTGGATGTTTAATACACTTAAGG + Intronic
962114979 3:132495280-132495302 GTGTATGTTTAATAAACTTCTGG + Intronic
963227629 3:142878269-142878291 GTGGGTGTTCCATTTATTTCGGG + Intronic
964409211 3:156380744-156380766 TTTGATGTTTAATACGTTTCAGG - Intronic
964428095 3:156574345-156574367 CTGGGTGTTTAATACATTTATGG + Intergenic
965477751 3:169178031-169178053 CTGAGTAGTTAATACATTTCAGG + Intronic
967604414 3:191427255-191427277 AAGACTGTTTAATACATTTCTGG - Intergenic
969283713 4:6189545-6189567 GTAGGTGGTTAATAGATTTTTGG - Intronic
970086316 4:12350658-12350680 GGGTTTGTTTAATACATATCAGG - Intergenic
970747308 4:19314903-19314925 TTTGGTATTTAAGACATTTCAGG + Intergenic
971039402 4:22734933-22734955 GGGGCTGTTTATTACATTTTTGG - Intergenic
971944918 4:33262094-33262116 TTGAGTGTCTAATACGTTTCAGG - Intergenic
972663214 4:41137864-41137886 TTTGGTGTTTAATTCATTTGGGG - Intronic
973298074 4:48549066-48549088 GTAGGTGTTCAATACATGTTTGG + Intronic
976455552 4:85242971-85242993 TTAGGTGTTTAATCCATTTGGGG + Intergenic
977982864 4:103346074-103346096 GGGGGTTTTTAATATATTTAAGG + Intergenic
978649784 4:110986841-110986863 GTGGATGTTAACTACATTTTTGG + Intergenic
980438140 4:132807641-132807663 TTAGGTCTTTAATTCATTTCAGG - Intergenic
982375260 4:154682814-154682836 GTAGGTGCTCAATACATTTGTGG + Intronic
983160726 4:164410801-164410823 GTGGGTGTTTAAAATAATTGTGG - Intergenic
985347057 4:189017243-189017265 GTTCTTGTTTAATCCATTTCAGG + Intergenic
985688858 5:1295766-1295788 GTGGGTGATTAACAGATTTGGGG - Intergenic
986497110 5:8355118-8355140 GTGTGTATTTAATAAATTTTAGG - Intergenic
986533870 5:8766129-8766151 ATGAGTGTTTAGTACATGTCAGG + Intergenic
986816050 5:11412967-11412989 GTGGGTTCTGAATACATTTACGG + Intronic
987211493 5:15688396-15688418 GTGAGTGTCAAAAACATTTCTGG + Intronic
987345707 5:16977081-16977103 CTGAGTGTCTAATACATTTCAGG + Intergenic
987523317 5:19015875-19015897 GTAGGTGTTGAATAGATTTATGG - Intergenic
989199293 5:38747770-38747792 ATGGGTGTTTAATACCTTATTGG + Intergenic
991176813 5:63698082-63698104 GTTGATGTTTAAAACATTTGGGG - Intergenic
992024840 5:72659823-72659845 GTGGGTGAGGAATCCATTTCAGG + Intergenic
992230869 5:74662776-74662798 ATAGCTGGTTAATACATTTCTGG - Intronic
998222305 5:140294918-140294940 GTGGGTATTTTTTACATTTAAGG - Intronic
998721236 5:144952445-144952467 TTGAGAGTTTACTACATTTCAGG - Intergenic
998968995 5:147570893-147570915 CTGGGTCTTTTATACATTGCTGG - Intergenic
1000396872 5:160785038-160785060 AAGGGTGTGTAACACATTTCTGG + Intronic
1010929137 6:81778896-81778918 GTGAGTGTTTACTACATGTCAGG - Intergenic
1011762569 6:90584479-90584501 GTGTGTGTTTAGGAAATTTCTGG - Intronic
1016922707 6:149311887-149311909 TTGGGTGGTCAATACATTTAAGG - Intronic
1020915999 7:14193379-14193401 GTAGGTGTTGAATGTATTTCTGG - Intronic
1021110057 7:16683281-16683303 GTGAGTTTTTAATACATGTTTGG + Intronic
1021564773 7:22006397-22006419 GAGGCTGTTTAATCCATTCCAGG + Intergenic
1022307428 7:29160511-29160533 GTGGGTGTGTAATCCAGTCCTGG + Intronic
1027448509 7:78302634-78302656 TTGAGTGCCTAATACATTTCAGG + Intronic
1028061242 7:86319455-86319477 GTGTGTGTTTAAAACTTCTCAGG + Intergenic
1031424545 7:121589255-121589277 GTTGGGGTTTTATACATTTTAGG - Intergenic
1033087055 7:138352445-138352467 GTGGGAGTTTACAACATTTTAGG - Intergenic
1033535344 7:142307390-142307412 GTGTGTGTGTGATACCTTTCTGG + Intergenic
1034243699 7:149628337-149628359 GTGGTGGTTTTATACATTTTAGG + Intergenic
1035286773 7:157811850-157811872 GAGGCTGTTTTATACATTTTGGG + Intronic
1039793639 8:40894606-40894628 GAGTGTGGTGAATACATTTCAGG + Intronic
1040090032 8:43388530-43388552 GTGGCTGTTTAATTTATTTTAGG + Intergenic
1041344762 8:56885605-56885627 GTGGATGATTAATACATATATGG + Intergenic
1042399210 8:68326681-68326703 GTGGGGGTTTAATACATCACTGG + Intronic
1042882960 8:73514692-73514714 GTAGATTTTTAAAACATTTCTGG + Intronic
1046931127 8:119842828-119842850 GTGGGTGTTTTAAATTTTTCAGG - Exonic
1047112460 8:121805885-121805907 CAGGATGTTTAGTACATTTCAGG - Intergenic
1047226814 8:122961987-122962009 GTGGGTGTTAATTGCATCTCAGG + Intronic
1049878893 8:145047907-145047929 TTTGGTACTTAATACATTTCTGG - Intergenic
1050181603 9:2928675-2928697 CTGGGTTTTTAAAAAATTTCTGG + Intergenic
1051225079 9:14890630-14890652 GAGGGTATCTAAAACATTTCTGG + Intronic
1059501044 9:114754510-114754532 GCAGGTGTTTAATACAAATCTGG + Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1186324150 X:8460239-8460261 ATGGGTGTTCACTAGATTTCTGG + Intergenic
1188492374 X:30751067-30751089 TTGGGTTTTTAATACATTTTGGG + Intergenic
1188606923 X:32042597-32042619 GTGTGTGTATAATTTATTTCTGG + Intronic
1189372865 X:40443835-40443857 TTGGGTGTTTAATTCATTAAGGG - Intergenic
1196863176 X:120046370-120046392 GTGTGTGTGTAATACAATTGTGG + Intergenic
1196879926 X:120189974-120189996 GTGTGTGTGTAATACAATTGTGG - Intergenic
1196961982 X:121013758-121013780 GTGGTTGTAATATACATTTCTGG + Intergenic
1196982604 X:121231757-121231779 GTGGGTGTTTACCACAGTGCTGG + Intergenic
1199295659 X:146155386-146155408 GTGTGTGTGTATTACATTTAGGG + Intergenic
1200420600 Y:2962063-2962085 GTTGTTGTTTAATTCATTACTGG + Intronic
1200892946 Y:8342942-8342964 GGGGGATTGTAATACATTTCTGG + Intergenic
1200970170 Y:9144037-9144059 GTGGGTTTTTAATACATATCAGG + Intergenic
1201712101 Y:17003908-17003930 GTGGGTGTTTAACAAATATGAGG - Intergenic
1202140839 Y:21720281-21720303 GTGGGTTTTTAATACATATCAGG - Intergenic
1202146026 Y:21783517-21783539 GTGGGTTTTTAATACATATCAGG + Intergenic