ID: 924028732

View in Genome Browser
Species Human (GRCh38)
Location 1:239865884-239865906
Sequence CTGTGCTCAGAGAAGTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924028726_924028732 30 Left 924028726 1:239865831-239865853 CCACATGTTAGCTCCTTGAATAC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 924028732 1:239865884-239865906 CTGTGCTCAGAGAAGTGCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 260
924028728_924028732 17 Left 924028728 1:239865844-239865866 CCTTGAATACAGAGAGTTGGTCT No data
Right 924028732 1:239865884-239865906 CTGTGCTCAGAGAAGTGCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924028732 Original CRISPR CTGTGCTCAGAGAAGTGCCC AGG Intronic
900087769 1:906610-906632 CCTTGCTCAGAGAGCTGCCCAGG - Intergenic
900347351 1:2216073-2216095 CCGGGCTCAGTGAAGTGCCGAGG + Intergenic
900438557 1:2642519-2642541 GTGGGCTCAGGAAAGTGCCCGGG - Intronic
900597628 1:3489675-3489697 CTGTTCCCAGAGAATGGCCCAGG - Intergenic
900609598 1:3538966-3538988 CTGTACTCAGAGGAGTGATCCGG + Intronic
902127502 1:14228508-14228530 ATTTGCTCAGAGAAGGGCCATGG + Intergenic
902526553 1:17062177-17062199 CTGAGATCTCAGAAGTGCCCTGG + Intergenic
903772625 1:25773537-25773559 CTGAGCTCAGACCAGAGCCCCGG + Intronic
905884750 1:41485596-41485618 CAGTCCCCAGAGAAGTCCCCTGG - Intergenic
906542856 1:46601502-46601524 CTGTGTTCAGAGACCTGCACTGG - Intronic
909901509 1:81142278-81142300 ATGTGAACAGAGAATTGCCCAGG + Intergenic
910523364 1:88149200-88149222 TAGTACTCAGAGCAGTGCCCTGG + Intergenic
910988133 1:93026543-93026565 CTGTGCTCAGCCAAGTGCGGTGG + Intergenic
911832995 1:102578141-102578163 TTGTGCCCGGAGACGTGCCCAGG - Intergenic
916440208 1:164817430-164817452 CTGTGCTGAGGGAAGAGACCAGG - Intronic
916520891 1:165562730-165562752 AGGTGCTCAGAGAAGTAGCCAGG + Intronic
916627487 1:166573813-166573835 CAATGCTCAGAGAAGTGGGCAGG - Intergenic
920676095 1:208039757-208039779 CTGTGCCCACAGGAGTGCGCAGG - Exonic
922575015 1:226655511-226655533 TGGGGCTCAGAGAAGTCCCCTGG + Intronic
924028732 1:239865884-239865906 CTGTGCTCAGAGAAGTGCCCAGG + Intronic
1063460932 10:6214725-6214747 CTGTGCCCAGCTCAGTGCCCAGG + Intronic
1067466645 10:46503970-46503992 CTGAGCTCAGGGAAGGGCTCTGG + Intergenic
1067620543 10:47880635-47880657 CTGAGCTCAGGGAAGGGCTCTGG - Intergenic
1067977167 10:51039664-51039686 CTTTGCTCAGACCAGTGTCCTGG + Intronic
1068488892 10:57696885-57696907 CTGTGTAAAGAGAATTGCCCTGG - Intergenic
1069771247 10:70901722-70901744 CTGGGCCCACAGAACTGCCCAGG + Intergenic
1070129992 10:73649094-73649116 CTGTGGTCAGAGCAGTGTCAGGG - Intronic
1070313951 10:75293934-75293956 GAGGGCTCAGAGAAGAGCCCTGG - Intergenic
1070817704 10:79335742-79335764 CAGTTCTCAGAGGAGTGACCAGG - Intergenic
1071301721 10:84261229-84261251 CTGTGCTCAGAGGAGAGGCAGGG + Intergenic
1072621299 10:97081251-97081273 CTCTGCTCAGAGAAGTGACCAGG + Intronic
1072805067 10:98418937-98418959 CCGTGCCCTCAGAAGTGCCCAGG - Intronic
1073642236 10:105264451-105264473 CTGAGCTCAGAAAAGTCCCCTGG + Exonic
1074997064 10:118766774-118766796 CAGTGCTCAGAGAATAGCTCAGG + Intergenic
1075808928 10:125210255-125210277 CTGGGCCCTGGGAAGTGCCCTGG + Intergenic
1075813745 10:125247938-125247960 CTGTCCTCAGAGAGGTGCCCTGG - Intergenic
1076337434 10:129717739-129717761 CTGTCCTCAGAGAAGAGTCAGGG - Intronic
1077186430 11:1237380-1237402 CTGTGGTCAAAGGAGTGGCCGGG - Intronic
1077921882 11:6647433-6647455 CAGTGGCCAGAGCAGTGCCCGGG + Intronic
1078563778 11:12395963-12395985 CTATGCTCAGAGCATTGCCAAGG - Intronic
1080210918 11:29783978-29784000 CTATGCTTAGAGCAGTGCCTGGG - Intergenic
1080397582 11:31904033-31904055 CTGACTTCAGAGAATTGCCCAGG - Intronic
1080419670 11:32098771-32098793 CTGTGCTCAGAGAACAGCCCAGG - Intronic
1080634655 11:34113066-34113088 CTTTACTCAGGGAAATGCCCTGG + Intronic
1081496197 11:43612994-43613016 GTGAGCTCAGAAAAGTACCCAGG + Intronic
1083363539 11:62128012-62128034 CTGTGAGCAGAGAGGGGCCCTGG + Intronic
1083694453 11:64433328-64433350 CTTTGCTCAGAGTCGTGTCCTGG + Intergenic
1084539351 11:69776404-69776426 CTGTGACCAGAGATGTCCCCAGG + Intergenic
1084681858 11:70670939-70670961 CCGTGCCCAGAGACGTGCGCTGG + Intronic
1084953559 11:72679653-72679675 CTGAGGTCAGAGGGGTGCCCAGG + Intergenic
1086309572 11:85520937-85520959 CTTTGCCCAGAGAAATGTCCTGG - Intronic
1087742298 11:101901894-101901916 TTCTGCACAAAGAAGTGCCCAGG + Intronic
1089618692 11:119709816-119709838 TTGTGGTGAGAGAAGTGGCCTGG - Intronic
1089790258 11:120937740-120937762 CTGTGCCCAGGGAAGAACCCTGG + Intronic
1090261386 11:125323202-125323224 CTGGGCTCAAAGCAGAGCCCAGG - Intronic
1090759547 11:129824278-129824300 CTGTTCTCAGACAAGTCTCCAGG - Intronic
1090834189 11:130441948-130441970 CTGAGGTCAGAGGAGTCCCCAGG + Intergenic
1091459482 12:633103-633125 CAGTTCTCAGAGAACTTCCCTGG - Intronic
1091620184 12:2081634-2081656 CTGTGCTGAGAGAACTACCAAGG + Intronic
1091754125 12:3040748-3040770 CAGTGCTCAGAGACGTACCCCGG + Intergenic
1092713788 12:11366740-11366762 CTGTGCTCAGGGGATTCCCCCGG + Intronic
1094653419 12:32399348-32399370 CTGTGCCCAGCGGAGCGCCCTGG - Intergenic
1096427317 12:51515085-51515107 CTGGGCTCAGAAAAGTGCCATGG - Exonic
1101504817 12:105336596-105336618 CTGCGCTCAGAGAAGTGCTGAGG + Intronic
1102188775 12:110970147-110970169 CTGGGCACAGAGAAGGGCCTCGG - Intergenic
1103478290 12:121234191-121234213 CTGTGCTCAGAAAAGGTCCATGG + Intergenic
1103921775 12:124403029-124403051 CTGGGTTGAGAGAGGTGCCCTGG + Intronic
1104354604 12:128074278-128074300 GTTTGCTCAGAGAAAAGCCCAGG + Intergenic
1104767702 12:131341027-131341049 GTCTGCTCAGAGCAGGGCCCTGG - Intergenic
1104946238 12:132416050-132416072 CAGAGCTCAGTGAGGTGCCCTGG + Intergenic
1106946566 13:34833972-34833994 CTGAGCCCAGAGAAGAGACCAGG + Intergenic
1106963653 13:35033072-35033094 TTTTGCTCAGACCAGTGCCCTGG + Intronic
1107014371 13:35696619-35696641 CTGTGCTAGGAGCAGTGCCACGG + Intergenic
1107055595 13:36100278-36100300 CTGTGGTCAGAGAATTGCTTGGG + Intronic
1107282585 13:38754020-38754042 CTGTGCTTAGAGAAATGCAGAGG + Intronic
1107834481 13:44402628-44402650 CTGTGCACAGAGAAATGCCAGGG + Intergenic
1112560102 13:100505399-100505421 CCGTGTTCAGAGAGGTTCCCAGG - Intronic
1113074650 13:106455519-106455541 CTGTGGTCAGGGAAGGGTCCTGG - Intergenic
1115304221 14:31917372-31917394 ATGTGCTCAGAGAAGTGCATAGG - Intergenic
1115727058 14:36228511-36228533 CAGAGCTCAGAGAAATGCTCTGG - Intergenic
1117530575 14:56657092-56657114 CTGTTCTCTGAGAAGTCCCTGGG - Intronic
1118356278 14:65016583-65016605 CTGTGACCAGAGAGGGGCCCCGG - Intronic
1119266792 14:73267481-73267503 CTGTGCACAGAGGAGTGTCAAGG + Intronic
1119434248 14:74587453-74587475 CTCTCTTCAGAGAGGTGCCCTGG - Intronic
1119740062 14:77008312-77008334 CTCTGCCCAGAGATGTCCCCAGG - Intergenic
1121306337 14:92910098-92910120 CTCTGCTCAGAGAAGCACCTGGG + Intergenic
1121624037 14:95371659-95371681 CTGTGCTCGGGGAAATGCTCTGG + Intergenic
1121724341 14:96135563-96135585 CTGTGGTCTGAGAAGTGGCGGGG + Intergenic
1122133373 14:99618956-99618978 CAGTGCCCAGAGCTGTGCCCAGG - Intergenic
1123055215 14:105566249-105566271 CAGTCCTCTGGGAAGTGCCCTGG + Intergenic
1123079664 14:105686093-105686115 CAGTCCTCTGGGAAGTGCCCTGG + Intergenic
1125826639 15:42682113-42682135 GTCTGCTCAGAGAAGAGACCTGG + Exonic
1128140322 15:65295569-65295591 CTGTGCCCAGCTAATTGCCCAGG - Intronic
1128575252 15:68769927-68769949 CTGTGCTGAAAGAACTGCCTGGG - Intergenic
1129555272 15:76501783-76501805 CTGAGAACAAAGAAGTGCCCAGG + Intronic
1129795308 15:78371993-78372015 CTGTACAAAGTGAAGTGCCCTGG + Intergenic
1130990690 15:88874036-88874058 CTGTGCTCAGCGAGATGGCCGGG - Intronic
1131146611 15:90017953-90017975 CTTTGCTAAGAGAGATGCCCTGG - Intronic
1131230188 15:90654031-90654053 GTCTGCTCTGGGAAGTGCCCAGG - Intergenic
1131892294 15:96985087-96985109 CTGAGCTCAGCGAAGTGGACAGG - Intergenic
1133281393 16:4667366-4667388 CTGTGGTGACACAAGTGCCCTGG + Intronic
1134429591 16:14190775-14190797 CTGTCCTCCAAGAAGTGACCTGG + Intronic
1134535514 16:15023823-15023845 CACTGCTCAGAGCAGAGCCCAGG - Intronic
1137271075 16:46902504-46902526 CTGTGGGCAGAAAAGTGCTCAGG - Intronic
1138330672 16:56212989-56213011 CTGTGGGCAGAGACGTCCCCAGG + Intronic
1139319864 16:66105694-66105716 CTGTGCTCAGAGAAAATCCCTGG - Intergenic
1139860529 16:70016960-70016982 CACTGCTCAGAGCAGAGCCCAGG + Intergenic
1140391298 16:74589422-74589444 CTGTGCTGAGGGAAGGGCACTGG + Intronic
1140409847 16:74734917-74734939 CTCTGCTCAGAAAGCTGCCCTGG - Intronic
1142251301 16:88993259-88993281 CTGTGCTCAGAGCCCAGCCCCGG + Intergenic
1142642957 17:1295315-1295337 CTGTCCCCGGAGAAGTGGCCAGG - Intronic
1143373683 17:6455307-6455329 CTGTGCTCAGAGCAGGGAGCGGG - Exonic
1144046033 17:11455624-11455646 CTTTGCTCCCAGAAGAGCCCAGG + Intronic
1145254461 17:21315027-21315049 CTCTGCTCAGAGAAGTGCAGGGG + Exonic
1145322136 17:21772934-21772956 CTCTGCTCAGAGAAGTGCAGGGG - Intergenic
1146277985 17:31527079-31527101 GAGCGCTCAGAGAAGAGCCCTGG + Intronic
1146587903 17:34098512-34098534 ATGTGCTCAGGGAAGGGCCCTGG + Intronic
1146896306 17:36544731-36544753 CTGGGCTCCGAGAAGGGCGCCGG + Intergenic
1146987056 17:37229966-37229988 CTGAGGCCAGAGAATTGCCCAGG + Intronic
1148237237 17:45976983-45977005 CTGCACTCAGAGTTGTGCCCAGG + Intronic
1148360063 17:47004393-47004415 CTGTGCTGTGGGAAGTGCCAGGG - Intronic
1148443513 17:47724301-47724323 CTGGGCACTGAGAAGGGCCCTGG - Intergenic
1152921738 17:83069298-83069320 CTGTGCTCCTAGGGGTGCCCGGG + Intergenic
1153490665 18:5644656-5644678 CTGTGCAGAGAGAACTGGCCAGG + Intergenic
1153781602 18:8499976-8499998 CTGTTCTCAGAGCAGGTCCCTGG - Intergenic
1156426518 18:37019551-37019573 ATGTGCTCAGAGATGTGCCTAGG + Intronic
1158557975 18:58490834-58490856 GAGAGCTCAGAGAAGAGCCCAGG + Intronic
1158712798 18:59852422-59852444 CTGTGCTCTGCCAAGTGCTCGGG - Intergenic
1160004510 18:75059983-75060005 CTGTCCCCAGACACGTGCCCAGG + Intronic
1160318942 18:77872410-77872432 CTGTGATCATATAAGTGCCCAGG + Intergenic
1160959504 19:1713051-1713073 CTGGGCACAGAGCAGGGCCCTGG + Intergenic
1162480546 19:10924575-10924597 CAGTGCTCAGGGCAGAGCCCTGG - Intronic
1163288141 19:16362072-16362094 CTTTTCTCAGAGAAGCGCCCCGG - Intronic
1164111637 19:22166606-22166628 CTGTGCTCAGAGTAGTTACTGGG - Intergenic
1164590896 19:29506225-29506247 CAGTTTTCAGAGAAGGGCCCCGG - Intergenic
1165785991 19:38462392-38462414 CTGTCCCCAGACCAGTGCCCTGG + Intronic
1168236918 19:55069289-55069311 CTGTTCTCAGAGGAACGCCCAGG + Intronic
925820206 2:7792582-7792604 CTGTGCTCAGAGGTGTACACAGG - Intergenic
925989844 2:9245843-9245865 CAGTGCCCAGAGCAGTGCCTGGG + Intronic
926476513 2:13329228-13329250 CTGTGCTCTCAGAAGGGTCCAGG + Intergenic
927880108 2:26684215-26684237 CTGTCCTCAAAGAAGAGCCCTGG - Intergenic
927883846 2:26706666-26706688 CCGTGCCCAGCTAAGTGCCCTGG + Intronic
928180210 2:29063286-29063308 CTCATCTCAGAGAAGTGCTCAGG - Exonic
928397177 2:30951765-30951787 CTCTGCCCAGAGCTGTGCCCAGG - Intronic
930357661 2:50342786-50342808 CTGAGCTCATAGAATTGCTCTGG + Intronic
930432533 2:51297812-51297834 CTGTGATAAGGGAAGTGGCCTGG + Intergenic
933779076 2:85788882-85788904 CTTTGCTCTGAGGAGTGCTCAGG - Intergenic
936935215 2:117833381-117833403 CAGTGCTCAGGACAGTGCCCTGG + Intergenic
937135533 2:119548491-119548513 CTGAGCTCACAAAAGTGTCCAGG - Intronic
938200975 2:129372990-129373012 CTGTGCTCAGAGGCATGCACTGG + Intergenic
938698460 2:133855427-133855449 CTGTGCTTAGAACAGTGCCTGGG + Intergenic
939142316 2:138369606-138369628 CAGTGCTTAGAGCAGTGCCTGGG - Intergenic
941772712 2:169361917-169361939 CTGCGCTCTGAGCAGAGCCCGGG + Intronic
942152299 2:173089090-173089112 CTCTGCTGAGTGAAGTGCACAGG - Intronic
946126978 2:217571405-217571427 CAATGCTAAGAGCAGTGCCCTGG + Intronic
946365701 2:219247701-219247723 CTCTGCACAGAGAAGAGCTCTGG - Exonic
946560152 2:220903849-220903871 CTGTCCTCAAAGCAGAGCCCGGG + Intergenic
947858118 2:233338258-233338280 CAGAGCTCAGAGAAGGGGCCTGG + Intronic
948542201 2:238699034-238699056 CTGTGCTTCCAGAAGGGCCCTGG - Intergenic
948555087 2:238804060-238804082 CTGCCATCAGAGAAGTGCTCTGG - Intergenic
948642277 2:239383268-239383290 CAGGGCTCAGAGCAGTGCCAGGG - Intronic
948755262 2:240155797-240155819 GTTTGCTCAGAGAAGGGACCTGG - Intergenic
1169194560 20:3676182-3676204 CTGTGCTCAGGAAGGTGCCTTGG - Intronic
1169366968 20:5000450-5000472 CTGCGCGCAGAGAAGGCCCCGGG - Intronic
1170731498 20:18979618-18979640 CTGTGTTAAGAGCAGTGCTCAGG + Intergenic
1173826815 20:46053031-46053053 CTGCCCTCAGAGAAGCGCTCAGG - Exonic
1174058360 20:47815168-47815190 TTGTGGTCAGAGAGCTGCCCAGG + Intergenic
1174146333 20:48455180-48455202 ATGTTCTGAGAGAAGAGCCCAGG + Intergenic
1175052238 20:56166394-56166416 CTTTGCTCAGAGGATTTCCCTGG - Intergenic
1175519654 20:59591939-59591961 CTGCTCCCAGAGAAGTGCCGTGG + Intronic
1175709241 20:61206098-61206120 TTGTGCTAGGACAAGTGCCCTGG - Intergenic
1175857967 20:62132974-62132996 CTGGGCACAGAGAGGAGCCCTGG - Intronic
1175877439 20:62237045-62237067 CTGGGCCCAGAGATGTGGCCTGG + Intronic
1175899440 20:62354261-62354283 CTGTGCGGAGAGAAGGGCCTGGG - Intronic
1175989499 20:62780822-62780844 GTCTGCTCAGAGAAGAGCCCAGG + Intergenic
1179405486 21:41122186-41122208 CTGTGCTCATGAAGGTGCCCCGG + Intergenic
1179887109 21:44318921-44318943 CAGTGATCAGAGCAGAGCCCTGG + Intronic
1180656849 22:17429017-17429039 CAGTGCTCAGATAACTGCCTAGG + Intronic
1182141446 22:27962864-27962886 CTGTGCTCAGAGACTCGGCCTGG - Intergenic
1182312761 22:29420943-29420965 CTGGGCTTAGAGAAGGGCTCAGG - Intronic
1184320575 22:43739537-43739559 CTGGGCTCTGAGAAGAGTCCAGG - Intronic
1184893973 22:47396476-47396498 CTGGGCTCAGAGATGAGCCCTGG - Intergenic
951105793 3:18740744-18740766 TTGTGCTCAGTGAAGTCCACAGG + Intergenic
952884515 3:38004124-38004146 CGGGGCTCAGAGGAGGGCCCAGG + Intronic
953472233 3:43177272-43177294 CTGTCCTGGGAGAAGTGCACTGG + Intergenic
953532225 3:43748963-43748985 CTGTGCTCAGTGACGTCTCCTGG - Intergenic
953672450 3:44974926-44974948 CTATGCCCAGAGAAGTTCCCTGG - Intronic
953777593 3:45834984-45835006 CTGTGCTTAGAGTAGTTCACGGG + Intronic
954128366 3:48546159-48546181 CTGTGCTCATACATGGGCCCAGG - Intronic
954916783 3:54155280-54155302 CTGGGCTCAGAGTACTCCCCAGG + Intronic
955176314 3:56617507-56617529 CTGTTTTGAGAGAGGTGCCCAGG - Exonic
956556271 3:70526449-70526471 AGGTGCTCAGAGAAGTCCCTGGG - Intergenic
957127997 3:76187144-76187166 TTCAGCTCAGAGAAGTGCCTAGG - Intronic
963790432 3:149577558-149577580 CTCTGCTTAGAGAACTGCCCAGG + Intronic
964397154 3:156257505-156257527 CTGTCCTCAGAGTAGGGCTCTGG - Intronic
964790598 3:160450410-160450432 CTGTGCTCAGCCCAGTGCTCCGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968605924 4:1535558-1535580 GTGTGCTCAGAGAAGTCACCTGG + Intergenic
968961777 4:3749176-3749198 CAGAGCTCAGAGCACTGCCCAGG + Intergenic
969095233 4:4727856-4727878 CAGTCCTCAGAGAGATGCCCAGG - Intergenic
969230709 4:5828316-5828338 CTGTCCTCAGACAGGAGCCCAGG + Intronic
969615192 4:8247893-8247915 CTGTGCCGGGGGAAGTGCCCTGG + Intergenic
979814357 4:125081538-125081560 CTCTGCTCAGAGAAAAGTCCTGG + Intergenic
982993992 4:162317521-162317543 CTGGGCTCTGAGAAGTGCTTTGG + Intergenic
984702312 4:182826131-182826153 CAGGGCTCACAGAAGGGCCCTGG - Intergenic
984883710 4:184431455-184431477 CTGTGCACAGAGGAGTGCACTGG + Intronic
985729911 5:1541291-1541313 CTGTGCACACAGCAGGGCCCAGG - Intergenic
986826451 5:11527792-11527814 CTGTTCTCTGTTAAGTGCCCAGG - Intronic
987075594 5:14379182-14379204 CTGTCATCACAGAATTGCCCTGG - Intronic
987169326 5:15237917-15237939 TTGAGCTCAGAGGAGGGCCCAGG - Intergenic
988121917 5:26975113-26975135 AAGTGCTCACAGAATTGCCCTGG + Intronic
989577951 5:43006513-43006535 CTGGGCTCTGACAAGTGCCTGGG - Intergenic
994985307 5:106925894-106925916 CTGTTCTCAAAGAAGTTCTCTGG + Intergenic
996532564 5:124541770-124541792 CTGTCCTCAGGGCAGTGGCCTGG + Intergenic
996755346 5:126929379-126929401 GTGGGCTCAGGGAAGTCCCCAGG + Intronic
997242927 5:132321256-132321278 CTGTGCCCAGAGATCAGCCCAGG - Intronic
997656845 5:135561493-135561515 CTGGGCTCAGGGAGGTACCCAGG + Intergenic
998371772 5:141666474-141666496 CTGTGCTCAGCGCCGGGCCCAGG - Exonic
999311973 5:150557460-150557482 CTGTGGTGTGAGAAGAGCCCTGG + Exonic
999382993 5:151134774-151134796 CTGTCCTCAGAGAGGTCCTCAGG - Intronic
1000196554 5:158964665-158964687 CTCAGCTCAGAGAATTTCCCTGG - Intronic
1000722899 5:164730464-164730486 CTGTCCTCAGAGAAGACCCAGGG + Intergenic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1001852421 5:174981069-174981091 CTCTGGTCAGTGAGGTGCCCCGG - Intergenic
1001880450 5:175239344-175239366 CTGTGGTTAGGGAAGTGCCTGGG - Intergenic
1002480184 5:179496065-179496087 CTTTCCTCAGAGTGGTGCCCTGG + Intergenic
1002567310 5:180119236-180119258 CGCTGCTCAGAGGAGAGCCCTGG + Intronic
1002790167 6:431646-431668 CAGTCCTCAGAGACATGCCCAGG - Intergenic
1004274456 6:14222989-14223011 CAGTGCTCAGAGCACTGCCCTGG + Intergenic
1005944424 6:30585127-30585149 CTCTCCTCAGAGAAGTTCTCGGG - Intronic
1007396190 6:41579034-41579056 GGGTGCTCAGAGAAGGACCCAGG + Intronic
1007956693 6:45924384-45924406 CCTTGCTCAGAGCAGTTCCCTGG + Intronic
1008380835 6:50838309-50838331 CTGTGCTCTGAAAAGTGCTCAGG + Intronic
1010171113 6:72976857-72976879 ATGTGTACAGAGAAGTGCTCAGG - Intronic
1012256642 6:97040575-97040597 CTGTACTCAGACACGTTCCCAGG + Intronic
1013602996 6:111722073-111722095 CAGTGCTCAGAAGAGTGCCCAGG - Intronic
1013692556 6:112663135-112663157 CTGTGCTCAGGAAAGTGCCAGGG + Intergenic
1016989650 6:149920422-149920444 ACAGGCTCAGAGAAGTGCCCAGG + Intronic
1017062957 6:150503534-150503556 CTGTGCTCAGAACAGTGGCATGG + Intergenic
1017122276 6:151035574-151035596 CTGTGCACAGAGCAGTGCTTGGG - Intronic
1018197529 6:161368105-161368127 CTGTGCTCTCAAAAGTCCCCGGG - Intronic
1018765266 6:166927954-166927976 ATGAGCTCAGAGAAGGGCCGAGG + Intronic
1019637619 7:2084489-2084511 CTGTGCTCACGGAGGTCCCCAGG + Intronic
1024685323 7:51738387-51738409 CTGTGCAGACAGAAGTGTCCAGG + Intergenic
1029709024 7:102289556-102289578 TTGAGCTCAGAGAAAGGCCCAGG + Intronic
1029947834 7:104552015-104552037 CCTTGTTCAGAGAAGTGGCCTGG + Intronic
1031864226 7:127020285-127020307 CTCTGCTCAGGGCTGTGCCCAGG - Intronic
1032191174 7:129766862-129766884 CTGTGCTCCAAAAGGTGCCCGGG + Intergenic
1032991052 7:137395484-137395506 CTGTGCTTATGGAAGTGCCTGGG - Intronic
1034126219 7:148674413-148674435 CAGTTCTCAGAGATGTGCCTTGG + Intergenic
1034336013 7:150323859-150323881 CCGTGCTCAGAGACGGGCTCTGG + Intronic
1034343031 7:150369964-150369986 CTGTGCACAGGGAAGACCCCAGG - Intronic
1034834844 7:154342525-154342547 CTGTCCTCTGAAAACTGCCCCGG - Intronic
1035040255 7:155921767-155921789 CTGTGATCATTGCAGTGCCCAGG + Intergenic
1037637824 8:20716313-20716335 GTGTGCTCACAGAAGGACCCTGG - Intergenic
1037795235 8:21988004-21988026 CTGTGCTTAGAGATATGGCCCGG + Intronic
1039001542 8:32985929-32985951 CTGTACTCAGAGGAGAGCCAAGG - Intergenic
1039567257 8:38560302-38560324 CTGGGGTCAGACAAGGGCCCAGG + Intergenic
1040673520 8:49721266-49721288 TTCTGGTCAGAGAAGTGTCCTGG + Intergenic
1041044995 8:53880420-53880442 CAGAGCTCAGAGAGGCGCCCCGG + Intronic
1041168512 8:55116063-55116085 CTTTGCTCAGAGAAGTGGAGTGG + Intronic
1044235821 8:89828913-89828935 CTGTGGTCAGAGAAGTGGGAAGG + Intergenic
1044315944 8:90750402-90750424 ATGTGCTGAGAGAAGTGCATAGG - Intronic
1046658961 8:116927857-116927879 CTGTGCTCAGAAAATTTCTCAGG - Intergenic
1047666496 8:127097279-127097301 CTGAGCTCAGAGAAGTTCAATGG - Intergenic
1048252174 8:132875881-132875903 CTGTGCCCAGAGAAGTCACTGGG - Intronic
1049490538 8:142898224-142898246 CTGTGTTTACAGGAGTGCCCTGG + Intronic
1051364290 9:16310176-16310198 CGCTGCACAGGGAAGTGCCCGGG + Intergenic
1052132947 9:24872057-24872079 GTGAGCTCTGAGCAGTGCCCTGG + Intergenic
1052389770 9:27866227-27866249 CTGTTATCAGAGAAGTGCCTGGG + Intergenic
1053293841 9:36899475-36899497 CTGGGCTCAGAGGAGTGGCCTGG - Intronic
1055248527 9:74275936-74275958 CTGGGGGCAGAGGAGTGCCCTGG - Intergenic
1055913286 9:81374992-81375014 CTGTGCACAGAGGAGTCCCATGG - Intergenic
1056307273 9:85302433-85302455 CTGTCCTCAGAGAAATGATCTGG - Intergenic
1056532892 9:87502569-87502591 GTGTACACAGAGAGGTGCCCAGG - Intronic
1056978352 9:91282568-91282590 CTGAGGTCAGAGAAGTAGCCAGG + Intronic
1058833095 9:108836795-108836817 TTGTGCTCTGAGAAGAGCTCTGG - Intergenic
1061074027 9:128329913-128329935 CTGGGATCAGAAAAGTGCCCAGG + Intronic
1061388168 9:130302715-130302737 CTGAGCTTAGAGAGGTGACCAGG + Intronic
1061852437 9:133424017-133424039 CTGTGCCCAGAGCAGGGTCCAGG + Intronic
1062651963 9:137582490-137582512 CTGTGCCCAGGGTAGAGCCCGGG + Exonic
1186456166 X:9711845-9711867 CTTGGCTCAGAGCAGTGCCCCGG + Intronic
1187197348 X:17100338-17100360 TGCTGCTCAGAGCAGTGCCCAGG + Intronic
1190333345 X:49248833-49248855 CTCTGCCCAGAGATGTGTCCCGG + Exonic
1191105404 X:56769155-56769177 CTGTGCACAGACGAGTGCCTGGG - Intergenic
1191106397 X:56774557-56774579 CTGTGCACAGACGAGTGCCTGGG - Intergenic
1191107390 X:56779959-56779981 CTGTGCACAGACGAGTGCCTGGG - Intergenic
1195570233 X:106392401-106392423 CTGTGCTAAGTGAAGCCCCCAGG + Intergenic
1196366885 X:114933495-114933517 CTGGGCTCAGAAAAGTGCCGTGG + Intergenic
1197723727 X:129761890-129761912 CTGTGCTCATAGAGATGCTCTGG + Intronic
1199969616 X:152849871-152849893 TTGTCCTTAGAGAAGCGCCCAGG + Intronic
1200893022 Y:8343792-8343814 CCTTACTCAGAGAAGGGCCCAGG - Intergenic
1200900522 Y:8426740-8426762 CTTTACTGAAAGAAGTGCCCAGG + Intergenic